Biosynthesis method of alpha-lipoic acid, engineered strain and preparation method thereof

A technology for biosynthesis and engineering strains, applied in the field of biosynthesis of alpha-lipoic acid, which can solve problems such as complex process, cumbersome steps, and doubts about product safety.

Active Publication Date: 2015-03-25
GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Disadvantages of chemical synthesis to produce lipoic acid: cumbersome steps, complex process, and use of chemical raw materials, and a large amount of toxic catalysts are used in the synthesis process, the safety of the product is seriously questioned
At the same time, it causes serious pollution to the environment and is an environmentally non-friendly process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biosynthesis method of alpha-lipoic acid, engineered strain and preparation method thereof
  • Biosynthesis method of alpha-lipoic acid, engineered strain and preparation method thereof
  • Biosynthesis method of alpha-lipoic acid, engineered strain and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0145] A preparation method of an engineering strain for biosynthesizing α-lipoic acid, comprising the steps of:

[0146] (1) Construction of prokaryotic expression vector pET28-lipD

[0147] The plasmid pGSS331 containing lipD and the expression vector pET28 were double digested with Nco I and Sal I, purified and recovered, and ligated with ligase to obtain the recombinant vector pET28-lipD, see Figure 1-A with Figure 1-B ;

[0148] The recombinant vector pET28-lipD was detected by double enzyme digestion with Nco I and Sal I, which showed that the lipD gene fragment carried by pET28-lipD was consistent with that on pGSS331. DNA sequencing and DNAstar software analysis showed that the protein encoded by lipD included the N-terminal 33 amino acid residues (1-33) and the middle 52 amino acid residues (238-289) of the pyruvate dehydrogenase E2 subunit, a total of 85 amino acids The residue composition is a hybrid lipoic acid domain (Miles and Guest1987); at the 3' end of th...

Embodiment 2

[0170] A preparation method of an engineering strain for biosynthesizing α-lipoic acid, comprising the steps of:

[0171] (1) Construction of the prokaryotic expression vector pET28-lipD: see step (1) of Example 1;

[0172] (2) Construction of the expression vector pSU18-lplA: see step (2) of Example 1;

[0173] (3) Preparation of recombinant vector pET28-lipD-lplA

[0174] A. Amplify the lipD gene fragment: see A in step (3) of Example 1;

[0175] B. Amplify the lplA gene fragment: refer to B in step (3) of Example 1;

[0176] C. Refer to C in step (3) of Example 1;

[0177] (4) Construction of the recombinant vector pBAD34-lipA-SD-metK (see Figure 4 )

[0178] A. Construction of cloning vectors pMD19-T-lipA and pMD19-T-metK

[0179] Using the total DNA of wild-type Escherichia coli MG1655 as a template, the lipA gene and the metK gene were amplified by PCR, and respectively TA cloned and connected to the expression vector pMD19-T to obtain pMD19-T-lipA and pMD19-T-met...

Embodiment 3

[0192] A preparation method of an engineering strain for biosynthesizing α-lipoic acid, comprising the steps of:

[0193] (1) Construction of the prokaryotic expression vector pET28-lipD: see step (1) of Example 1;

[0194] (2) Construction of the expression vector pSU18-lplA: see step (2) of Example 1;

[0195] (3) Construction of recombinant vector pET28-lipD-tac-lplA

[0196] In order to achieve an optimal balance between the expression levels of lplA and lipD, a tac promoter was added before lplA in this embodiment.

[0197] A. Amplify the tac promoter gene: use pfuDNA as a polymerase, plasmid pGSS331 as a template, Ptacpromoter down and Ptacpromoter up as primers, and PCR amplify to obtain a 105bp tac promoter gene;

[0198] Ptacpromoter up (upstream primer):

[0199] GTCTATGAATTCACTCCCCATCCCCCTGT (SEQ ID NO. 7);

[0200] Ptacpromoter down (downstream primer):

[0201] GAGCAGGCGTAATGTGGACATGGATCCTGTTTCCTG (SEQ ID NO. 8);

[0202] B. Amplify the lplA gene fragment: u...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an alpha lipoic acid biosynthesis method, an engineered strain and a preparation method thereof. The biosynthesis method is as below: cloning an Escherichia coli lipD gene, an lplA gene, a metK gene and a lipA lipoic acid synthase gene; constructing a lipoic acid structural domain protein overexpression vector; cloning lplA into the vector highly expressing structural domain protein in series way structure to ensure full caprylyl; constructing a lipA expression vector or expression vector in series connection with metK; transforming the 4 vectors into appropriate Escherichia coli strains, regulating and comparing the medium composition and culture conditions, and promoting the conversion of caprylyl structural domain protein to lipoyl. The preparation method of alpha-lipoic acid provided by the invention employs combined low value chemical raw materials and pure biological production method, and has the advantages of little toxic substances in the production process, less pollution to the environment, high safety of the synthesized lipoic acid and high yield; and the alpha-lipoic acid has high activity.

Description

technical field [0001] The invention relates to the field of biosynthesis of active substances, in particular to a biosynthesis method of α-lipoic acid, an engineering strain and a preparation method thereof. Background technique [0002] α-lipoic acid is a biologically active natural substance, its chemical name is 1,2-dithiolane-3-pentanoic acid, and its structural formula is as Formula I. As a cofactor, it widely exists in organisms, and it is usually covalently bound to the ε-amino group of lysine in protein molecules in the form of amide bonds. Lipoic acid is optically active, R-(+)-α-lipoic acid (D-lipoic acid) is the natural form of lipoic acid in the human body, and S-(+)-α-lipoic acid is inactive in the human body. [0003] [0004] Alpha-lipoic acid can be taken orally as a food, and is easily absorbed and utilized by biological tissues, and can pass through the blood-brain barrier to play the role of a so-called "universal antioxidant" with low toxicity. Ther...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C12N1/21C12P17/00C12R1/19
Inventor孙益嵘王海洪庞弘燊何伟
OwnerGUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI