Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of method for detecting Lactobacillus casei bacterial strain and its kit and primer pair

A technology of Lactobacillus casei and a kit, which is applied in the biological field, can solve the problems of long detection time, time-consuming and laborious, and high cost, and achieve the effects of low detection cost, improved detection efficiency, and simple result judgment

Active Publication Date: 2017-05-10
BRIGHT DAIRY & FOOD CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved in the present invention is to overcome the defects of long detection time, time-consuming and laborious, and high cost of the existing traditional technology, and provide a method for detecting Lactobacillus casei strains and its kit and primers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of method for detecting Lactobacillus casei bacterial strain and its kit and primer pair
  • A kind of method for detecting Lactobacillus casei bacterial strain and its kit and primer pair
  • A kind of method for detecting Lactobacillus casei bacterial strain and its kit and primer pair

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1 detects the primer synthesis and PCR detection of Lactobacillus casei bacterial strain

[0031] (1) Primer synthesis

[0032] Synthesize primers (synthesized by Shanghai Sangong Bioengineering Technology Service Co., Ltd.) that can PCR amplify the conserved sequence in the Lactobacillus casei histidine kinase gene sequence, and the primer sequences are as follows:

[0033] SEN2-L: 5'ATTAAAACCCCGCTGACCGT'3 (its nucleotide sequence is shown in SEQ ID NO.1 of the sequence table);

[0034] SEN2-R: 5'TCAACGAGCTGGTCAGCATT'3 (its nucleotide sequence is shown in SEQ ID NO.2 in the sequence table).

[0035] (2) PCR detection

[0036] Using the above primers, using the genomic DNA of Lactobacillus casei standard strain ATCC334 as a template, the PCR reaction system and reaction program were established and optimized. It was found that the following reaction system and reaction program can obtain a single amplification product of about 461bp.

[0037] Wherein, the ...

Embodiment 2

[0051] Embodiment 2 detects the specificity evaluation of Lactobacillus casei bacterial strain

[0052] 1), acquisition of strain genome DNA template

[0053] Get 1 strain (ATCC334) of Lactobacillus casei standard strain, 18 strains of Lactobacillus casei isolated bacterial strain and 14 strains (as shown in Table 1) of other varieties, collect thalline respectively according to the step described in Example 1 and press CTAB Genomic DNA was extracted by the method and used as a PCR reaction template for the detection of Lactobacillus casei.

[0054] 2), whether it is Lactobacillus casei strain detected by PCR

[0055] Take 2 μL of the DNA solution (DNA concentration: 30 ng / μL) of each strain obtained in step 1) and add it to the PCR reaction system as a PCR reaction template for amplification reaction.

[0056] The PCR reaction system is: 16.1 μL of sterile water, followed by adding 2.5 μL of 10×PCR reaction buffer, 25 mmol / LMg 2+ 2.0μL, 2.5mmol / L dNTP 1.0μL, 5μM primer SEN...

Embodiment 3

[0068] Embodiment 3 detects the sensitivity evaluation of Lactobacillus casei method

[0069] The method for extracting genomic DNA by the CTAB method described in Example 1 extracts Lactobacillus casei standard bacterial strain ATCC334 genome total DNA. Dissolve the obtained DNA in sterile water to a concentration of 1053ng / uL, and then use sterile water to make a 10-fold gradient dilution, and a total of 8 gradients were diluted: 105.3ng / PCR, 10.5ng / PCR, 1.05ng / PCR, 105pg / PCR, 10.5pg / PCR, 10.5pg / PCR, 105fg / PCR, 5μL of each gradient was used as a template and added to the PCR reaction system. Use SEN2-L as described in Example 1 and primer SEN2-R to amplify according to the PCR reaction system and PCR reaction program as described in Example 2, detect the amplified product by gel electrophoresis, and observe it in a gel imager Gel electrophoresis results, such as Figure 4 shown. Depend on Figure 4 It can be seen that a clear band (461bp) can be seen in the sixth swimmi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting lactobacillus casei strain and a kit and a primer pair thereof. The nucleotide sequences of the primer pair are respectively as shown in SEQ ID NO.1 in a sequence list and SEQ ID NO.2 in the sequence list. The method includes the following steps of: 1, performing PCR amplification by extracting genomic DNA of a sample to be detected as a template, and using the primer pair of which the nucleotide sequences are respectively as shown in SEQ ID NO.1 in the sequence list and SEQ ID NO.2 in the sequence list as primers; 2, detecting that whether a single amplification product exists at the 461bp position in the PCR amplification product of the step 1. The detection method is short in detection time, low in detection cost, reliable in detection result, and capable of being applied to detecting the lactobacillus casei in milk products.

Description

technical field [0001] The invention relates to the field of biology, in particular to a method for detecting Lactobacillus casei strains, a kit and primers thereof. Background technique [0002] Lactobacillus casei (Lactobacillus casei) belongs to the genus Lactobacillus (Lactobacillus), is a Gram-positive bacterium, does not produce spores, has no flagella, does not move, facultatively heterozygous lactose, and does not liquefy gelatin; the optimum growth temperature is 37 ° C, The G+C content is 45.6%-47.2%; the length of the bacteria is different, the two ends are square, and often form a chain; the colony is rough, off-white, sometimes slightly yellow, and can ferment various sugars. Lactobacillus casei exists in the human mouth, intestinal contents and stool and vagina, and is often found in milk and cheese, dairy products, feed, dough and garbage. Lactobacillus casei is a probiotic beneficial to human health. In 2001, the Ministry of Health announced the list of pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/245
CPCC12Q1/689
Inventor 陈万义任婧郭本恒刘振民
Owner BRIGHT DAIRY & FOOD CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products