Method for expression of chicken infectious bursal soluble VP 2-4-3 polypeptide
A technology for chicken infectivity and bursa, applied in chemical instruments and methods, botany equipment and methods, biochemical equipment and methods, etc., to achieve low-cost large-scale industrial production and strong antigen specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1: Optimization of VP 2-4-3 polypeptides
[0018] First, the characteristics of the peptide chain (SEQ ID NO: 4) synthesized under the guidance of the VP 2-4-3 gene (SEQ ID NO: 3) sequence were analyzed, and the levels of C-score, S-score, and Y-score were found to be low, and the peptide The first 70 amino acid sequences of the chain do not contain a strong polar hydrophobic region, and there is no obvious cleavage site, so it can be considered that the front part of the polypeptide chain has no characteristic signal peptide. The antigenic characteristics of the peptide chain show that the hydrophilic region is mostly concentrated in the front and end of the peptide chain, and the middle stage is a relatively long core hydrophobic region. The antigen characteristic region of the polypeptide chain is roughly the same as the hydrophilic region of the peptide chain, and also concentrated at the two ends of the peptide chain. The angle at which the peptide chain c...
Embodiment 2
[0021] Example 2: Secreted Expression of VP 2-4-3 Polypeptides
[0022] A gene fragment ATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCAGGTTTCGCTACCGTCGCTCAGGCT, VP 2-4- 3 The optimized gene fragment removes the ATG in the front section and connects directly to the OMPA signal peptide sequence. Add the ATG start codon in front of the signal peptide, then connect the modified VP 2-4-3 sequence, and place it directly downstream of the plasmid promoter, and then add NcoI, XhoI double restriction sites, OmpA ; Obtaining a fragment whose nucleotide sequence is SEQ ID NO:5. The gene fragment and the expression vector pET-28a(+) were double-digested with NcoI and XhoI respectively, and recovered from the gel. 4 μl gene fragment, 1 μl pET-28a(+) vector fragment, 0.5 μl T4 DNase, 1 μl ligase buffer, 3.5 μl ddH2O, ligated overnight at 4°C to make a plasmid ( figure 1 ). The recombinant plasmid was transformed into competent E.coli BL21(DE3), and cultured overnight on LB solid medium containi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More