New detection index for drug sensitivity under state of inflammatory bowel disease and application of new detection index in design of drug therapy scheme
A technology of natural drug resistance and peripheral blood, applied in the direction of drug combination, biological testing, pharmaceutical formulation, etc., can solve problems such as increasing drug doses, clinical treatment delays, errors, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific example 1
[0016] Specific example 1 TNBS model mice have natural drug resistance, the expression of P-gp in peripheral blood mononuclear cells is increased, the efflux is enhanced, and the accumulation level of intracellular cyclosporine CYSA is reduced.
[0017] TNBS mouse modeling: BALB / c mice were raised in the animal room for one week before modeling. After fasting for 24 hours, the mice were anesthetized with phenobarbital, and a 3.5F catheter was inserted into the intestinal tract from the anus to a depth of about 5.5cm. The model group was given TNBS dissolved in 30% ethanol at a dose of 100 mg / kg, and the control group was given 30% ethanol at the same volume. Afterwards, the mice were turned upside down for 3 minutes, and blood was collected from the orbit on the 3rd or 7th day after administration, and the mice were sacrificed in a sterile test tube containing heparin.
[0018] Peripheral blood lymphocyte extraction: Peripheral blood lymphocytes were extracted through the Lym...
specific example 2
[0029] Specific example 2 The levels of inflammatory factors (TNF-α, IL-β, IL-6, IL-17) and LPS in the plasma of TNBS model mice were significantly increased
[0030] TNBS mouse model: as shown in specific example 1
[0031] Detection of plasma inflammatory factors and LPS secretion levels: the determination of inflammatory factors in plasma was carried out according to the instructions of commercial ELISA kit (Excell, Shanghai, China), and the determination of LPS in plasma was carried out according to the instructions of commercial endotoxin detection kit (Xiamen Limulus Reagent Experimental Works Ltd).
specific example 3
[0032] Specific example 3: Inflammatory factors (TNF-α, IL-β, IL-6, IL-17) and LPS can induce human-derived macrophage THP-1 and human-derived lymphocyte CCRF-CEM efflux transporter P - Elevated expression of the gp gene
[0033] Human-derived macrophages THP-1 and human-derived lymphocytes CCRF-CEM were seeded in 6-well plates, and were given serum-free RPMI-16402 mL containing different concentrations of inflammatory factors and LPS, and incubated in a 37°C incubator for 72 hours Withdraw the drug, wash with Hank's at 4°C for 3 times, add 1mL Trizol reagent, pipette until clear and transparent without cell clumps, then carry out reverse transcription and real-time quantitative PCR experiments to detect the expression changes of MDR1. See specific example 1 for the specific operation plan.
[0034] The gene sequences of human MDR1 and internal reference ACTIN are as follows:
[0035] Human-MDR1-F 5'GCTGGGAAGATCGCTACTGA 3',
[0036] Human-MDR1-R 5'GGTACCTGCAAACTCTGAGCA 3', ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| density | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
