Check patentability & draft patents in minutes with Patsnap Eureka AI!

New detection index for drug sensitivity under state of inflammatory bowel disease and application of new detection index in design of drug therapy scheme

A technology of natural drug resistance and peripheral blood, applied in the direction of drug combination, biological testing, pharmaceutical formulation, etc., can solve problems such as increasing drug doses, clinical treatment delays, errors, etc.

Inactive Publication Date: 2015-04-22
CHINA PHARM UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Neglect of natural drug resistance may lead to delays in clinical treatment and erroneous increases in drug doses, accelerating the emergence of acquired drug resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New detection index for drug sensitivity under state of inflammatory bowel disease and application of new detection index in design of drug therapy scheme
  • New detection index for drug sensitivity under state of inflammatory bowel disease and application of new detection index in design of drug therapy scheme
  • New detection index for drug sensitivity under state of inflammatory bowel disease and application of new detection index in design of drug therapy scheme

Examples

Experimental program
Comparison scheme
Effect test

specific example 1

[0016] Specific example 1 TNBS model mice have natural drug resistance, the expression of P-gp in peripheral blood mononuclear cells is increased, the efflux is enhanced, and the accumulation level of intracellular cyclosporine CYSA is reduced.

[0017] TNBS mouse modeling: BALB / c mice were raised in the animal room for one week before modeling. After fasting for 24 hours, the mice were anesthetized with phenobarbital, and a 3.5F catheter was inserted into the intestinal tract from the anus to a depth of about 5.5cm. The model group was given TNBS dissolved in 30% ethanol at a dose of 100 mg / kg, and the control group was given 30% ethanol at the same volume. Afterwards, the mice were turned upside down for 3 minutes, and blood was collected from the orbit on the 3rd or 7th day after administration, and the mice were sacrificed in a sterile test tube containing heparin.

[0018] Peripheral blood lymphocyte extraction: Peripheral blood lymphocytes were extracted through the Lym...

specific example 2

[0029] Specific example 2 The levels of inflammatory factors (TNF-α, IL-β, IL-6, IL-17) and LPS in the plasma of TNBS model mice were significantly increased

[0030] TNBS mouse model: as shown in specific example 1

[0031] Detection of plasma inflammatory factors and LPS secretion levels: the determination of inflammatory factors in plasma was carried out according to the instructions of commercial ELISA kit (Excell, Shanghai, China), and the determination of LPS in plasma was carried out according to the instructions of commercial endotoxin detection kit (Xiamen Limulus Reagent Experimental Works Ltd).

specific example 3

[0032] Specific example 3: Inflammatory factors (TNF-α, IL-β, IL-6, IL-17) and LPS can induce human-derived macrophage THP-1 and human-derived lymphocyte CCRF-CEM efflux transporter P - Elevated expression of the gp gene

[0033] Human-derived macrophages THP-1 and human-derived lymphocytes CCRF-CEM were seeded in 6-well plates, and were given serum-free RPMI-16402 mL containing different concentrations of inflammatory factors and LPS, and incubated in a 37°C incubator for 72 hours Withdraw the drug, wash with Hank's at 4°C for 3 times, add 1mL Trizol reagent, pipette until clear and transparent without cell clumps, then carry out reverse transcription and real-time quantitative PCR experiments to detect the expression changes of MDR1. See specific example 1 for the specific operation plan.

[0034] The gene sequences of human MDR1 and internal reference ACTIN are as follows:

[0035] Human-MDR1-F 5'GCTGGGAAGATCGCTACTGA 3',

[0036] Human-MDR1-R 5'GGTACCTGCAAACTCTGAGCA 3', ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
densityaaaaaaaaaa
Login to View More

Abstract

The invention provides a new detection index for drug sensitivity under the state of an inflammatory bowel disease and application of the new detection index in the design of a drug therapy scheme, relates to multiple fields of pharmaceutical pharmacokinetics, pharmacology, cytobiology and molecular biology, creatively reveals natural drug-resistant phenomena of the inflammatory bowel disease and expounds related mechanisms. According to the new detection index, the phosphorylation of STAT3 is promoted by virtue of cell factors TNF-a, IL17 and LPS, which are excessively secreted in mice with the inflammatory bowel disease, in a way of STAT3 / Nf-kb, then the phosphorylation and the nuclear translocation of P65 are induced, the expression of peripheral blood monouclear cells P-gp is promoted, and the drug concentration of an immune inhibitor in the cells is reduced, the treatment effect of the immune inhibitor is inhibited, and the natural drug resistance is generated; by administering a P-gp specific inhibitor, the drug resistance phenomenon can be reverted. The new detection index prompts that P-gp expression quantity of peripheral blood lymphocyte can serve as an evaluation index of the natural drug resistance of patients with IBD (inflammatory bowel disease), and by virtue of the combination of the P-gp inhibitor, the decrease of the pharmaceutical effect caused by the natural drug resistance can be reverted, so that a new thought is provided for the treatment scheme of IBD.

Description

technical field [0001] The present invention relates to multiple fields such as pharmacokinetics, pharmacology, cell biology, molecular biology, etc., innovatively reveals the natural drug resistance phenomenon of inflammatory bowel disease, and discovers a drug based on peripheral blood mononuclear cell P- The new detection index of gp expression level is used to detect drug sensitivity in inflammatory bowel disease state, and the related mechanism is clarified. At the same time, it is proposed that drug therapy combined with P-gp inhibitor may be used to reverse the natural resistance of inflammatory bowel disease medicine. Background technique [0002] Inflammatory bowel disease (IBD) is a chronic intestinal inflammatory disease, mainly including Crohn's disease (CD) and ulcerative colitis (UC). It is not only prevalent in the United States and European countries, but the incidence rate in my country is also increasing year by year. The etiology and pathogenesis of IBD ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68A61K45/00A61P1/00A61P1/04
CPCG01N33/6893
Inventor 王广基张经纬刘嘉莉周芳陈倩莹
Owner CHINA PHARM UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More