Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant porcine pox virus vector vaccine expressing porcine circovirus type 2 capsid protein

A technology for recombining swine pox virus and porcine circovirus, which is applied in the directions of viruses/phages, antiviral agents, and viral antigen components to achieve the effects of high titer, stable expression and lasting protection.

Active Publication Date: 2017-08-25
邓舜洲 +7
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there has been no report on the construction of recombinant pox virus expressing porcine circovirus type 2 capsid protein using porcine pox virus SPV017-SPV020 as deletion sites

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant porcine pox virus vector vaccine expressing porcine circovirus type 2 capsid protein
  • Recombinant porcine pox virus vector vaccine expressing porcine circovirus type 2 capsid protein
  • Recombinant porcine pox virus vector vaccine expressing porcine circovirus type 2 capsid protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Construction of the universal transfer vector pSWE11

[0042] Two pairs of specific primers were designed according to the gene sequence of swine pox virus (GenBank: AF410153.1), which is the only one included in NCBI, to amplify the left and right homology arms of SPV017-SPV020 respectively:

[0043] SPV017-020-L11 (position in the genome: 11134bp-11158bp)

[0044] 5ˊ-C GAGCTC ( Sac Ⅰ) ACTTCTGTTTAGATTCACAGCATTT-3ˊ

[0045] SPV017-020-L12 (position in the genome: 12280bp-12300bp)

[0046] 5ˊ-CG GGATCC ( Bam H I) ACGATAGCAGCGTTGGTGTT-3

[0047] SPV017-020-R11 (position in the genome: 13365bp-13384bp)

[0048] 5ˊ-GC TCTAGA ( Xba I) CTCGAG ( xho I) GTC GAC ( Sal I)

[0049] GTGGGTGGTGTAGACTGTGT-3'

[0050] SPV017-020-R12 (position in the genome: 14416bp-14436bp)

[0051] 5ˊ-CC AAGCTT ( Hind III) TTCGATTTTTCACAGGTGGCT-3ˊ

[0052] Porcine pox virus (ATCC: VR-363) was extracted with Viral Nucleic Acid Extraction Kit (QIAGEN) TM ) geno...

Embodiment 2

[0060] Example 2 Amplification, cloning, identification and sequencing analysis of porcine circovirus type 2 ORF2 gene

[0061] 2.1 PCR primer design and synthesis

[0062] According to the reference gene sequence of porcine circovirus type 2 Chinese isolates published by NCBI (GenBank: HQ693093), a pair of specific primers for amplifying the ORF2 gene was designed, and the P28 promoter sequence was added to the 5' end of the upstream primer, and at the same time contained restriction endonuclease xho I and Sal Ⅰ enzyme cleavage site. Primers were synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0063] P28-ORF2-1:

[0064] 5' - gc CTCGAG ( xho I) TTTTTTTTTTTTTTTTTTTTGGCATATAAATGACGTATCCAAGGAGGCG-3'

[0065] P28-ORF2-2:

[0066] 5' - gc GTC GAC ( Sal Ⅰ) TTATCACTATTAAGGGTTAAGTGGGGGT - 3'

[0067] 2.2 PCR amplification

[0068] 10× EasyTaq Buffer 5 μL, dNTPs (2.5mM / L) 4 μL, P28-ORF2-1 (20 μM / L) 0.5 μL, P28-ORF2-2 (20 μM / L) 0.5 μL, Taq enzyme (5U / μL)...

Embodiment 3

[0081] Example 3 Preparation and determination of recombinant swine pox virus containing ORF2 gene

[0082] 3.1 PK15 cell preparation

[0083] PK-15 cells are passaged every 20 hours or so to maintain the logarithmic growth phase of the cells. Take a bottle of cells the day before transfection, and connect a bottle of cells to six wells of a six-well plate, each well contains 2 mL of culture medium, 37 ° C, 5% CO 2 Cultivate for about 20h.

[0084] 3.2 Acquisition of recombinant swine pox virus rSWE 11 / P28C

[0085] Pox virus strain VR-363 TM The virus solution was diluted with 5% DMEM, and the PK15 monolayer cells were infected with 0.05 MOI of pox virus, adsorbed for 2 hours, and shaken every 20 minutes during this period. Dilute the plasmid and liposomes before the last half hour of virus adsorption. Transfection was performed according to the operating instructions of the Lipofectamine 2000 kit (Invitrogen). After incubating in a 37°C incubator for 6 hours (still), the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides porcine circovirus type 2 recombinant vaccine using porcine pox virus as an expression vector, and the recombinant vaccine comprises porcine pox virus vector and porcine circovirus type 2 ORF2 gene. The recombinant vaccine of the present invention uses the porcine pox virus genome SPV017~SPV020 gene as the insertion site, and the porcine circovirus type 2 ORF2 gene is cloned into the vector pSWE11 as an exogenous gene to obtain the transfer vector pSWE11 / P28C; Viruses and transfer vectors were used to infect and transfect PK15 cells, and a recombinant pox virus expressing porcine circovirus type 2 capsid protein was obtained through homologous recombination. Compared with other reported sites, the recombinant swine pox virus of the present invention has the advantages of high virus titer, more efficient and stable expression of porcine circovirus type 2 capsid protein, etc., and can produce a strong immune response after immunizing animals, and induce immunity Animals produce high-titer antibodies and have good immune protection.

Description

technical field [0001] The invention belongs to the field of biological products and relates to a recombinant pox virus vector vaccine. Background technique [0002] Porcine circovirus type 2 (PCV2) can cause porcine circovirus disease (PCVD) in pigs. Porcine circovirus disease has various clinical manifestations, such as multisystemic wasting syndrome in weaned piglets, Porcine dermatitis nephrotic syndrome, congenital tremor in piglets and reproductive disorders in sows and other diseases. At present, PCVD is widespread in our country, causing great economic losses to the pig industry. The genome size of porcine circovirus type 2 (PCV2) is 1767bp or 1768bp. Analysis of its genome shows that there are 11 ORFs with a size of more than 200bp, and the molecular weight of the encoded protein is between 2 and 36KDa; ORF1 is the largest reading frame of PCV2, with a total of 945 bases, located on the positive strand DNA of the virus, encoding the virus Replication-related prot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K39/12A61P31/20C12N7/01C12N15/863
Inventor 邓舜洲蒋新华陈松昌张文波万文忠王建敏戴益民
Owner 邓舜洲
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More