A method for silencing oasl gene in df-1 cell line
A DF-1, cell line technology, applied in genetic engineering, plant genetic improvement, recombinant DNA technology, etc., can solve the problems of insufficient vaccine antigen quality and high production cost, and solve the problem of insufficient vaccine antigen quality and high production cost. , the effect of reducing production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0035] 1. Screening of siRNA that interferes with OASL gene transcription
[0036] 1. Design and synthesis of oligonucleotide sequence of shRNA that interferes with OASL gene
[0037] According to the OASL gene sequence registered in Genbank, combined with the addgene lentiviral vector construction program, siRNAs with 3 RNA interference target sequences were designed on the http: / / jura.wi.mit.edu / bioc / siRNAext website (such as figure 1 shown), and set up the control group Scramble at the same time, the sequence is as follows: sh1: 5'-AA GGACAGTAACAAGACCACA-3' (SEQ No.1); sh2: 5'-AA CTGCAGAAGAACTTTGTGA-3' (SEQ No.2); sh3: 5' -AAGTACTATTCCCCTGGAGGAT-3' (SEQ No.3); Scramble: CCTAAGGTTAAGTCGCCCTCG (SEQ No.4), according to the characteristics of the pLKO.1-TRC cloning vector, the DNA sequence of the siRNA and its corresponding complementary sequence are connected with a loop sequence to form a sense strand and antisense strand, and introduce linker sequences at both ends, and for...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com