A method for silencing oasl gene in df-1 cell line

A DF-1, cell line technology, applied in genetic engineering, plant genetic improvement, recombinant DNA technology, etc., can solve the problems of insufficient vaccine antigen quality and high production cost, and solve the problem of insufficient vaccine antigen quality and high production cost. , the effect of reducing production costs

Active Publication Date: 2018-06-26
POULTRY INST SHANDONG ACADEMY OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to overcome the deficiencies existing in the production of existing avian influenza vaccines, and provide a method for silencing the OASL gene in DF-1 cell lines, which can increase the antigen content of avian influenza virus in DF-1 cell lines to 5- 10 times, not only can solve the problem of insufficient vaccine antigen and high production cost, but also promote the research and development of bird flu bioreactor cell culture technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for silencing oasl gene in df-1 cell line
  • A method for silencing oasl gene in df-1 cell line
  • A method for silencing oasl gene in df-1 cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0035] 1. Screening of siRNA that interferes with OASL gene transcription

[0036] 1. Design and synthesis of oligonucleotide sequence of shRNA that interferes with OASL gene

[0037] According to the OASL gene sequence registered in Genbank, combined with the addgene lentiviral vector construction program, siRNAs with 3 RNA interference target sequences were designed on the http: / / jura.wi.mit.edu / bioc / siRNAext website (such as figure 1 shown), and set up the control group Scramble at the same time, the sequence is as follows: sh1: 5'-AA GGACAGTAACAAGACCACA-3' (SEQ No.1); sh2: 5'-AA CTGCAGAAGAACTTTGTGA-3' (SEQ No.2); sh3: 5' -AAGTACTATTCCCCTGGAGGAT-3' (SEQ No.3); Scramble: CCTAAGGTTAAGTCGCCCTCG (SEQ No.4), according to the characteristics of the pLKO.1-TRC cloning vector, the DNA sequence of the siRNA and its corresponding complementary sequence are connected with a loop sequence to form a sense strand and antisense strand, and introduce linker sequences at both ends, and for...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for an OASL (oligoadenylate synthetase-like) gene in a DF-1 cell line. The method comprises the following steps: according to the OASL gene, designing a plurality of siRNA of an RNA interference target sequence, and further screening siRNA for knocking down OASL gene expression on an mRNA level; constructing a slow virus vector containing the OASL RNAi gene; guiding the OASL RNA I gene into the DF-1 cell line through the slow virus vector, silencing the expression of the OASL gene, and improving multiplication titer of the avian influenza virus in the DF-1 cell line. According to the method disclosed by the invention, the antigen amount of the avian influenza virus in the DF-1 cell line can be increased by 5-10 times, the vaccine production cost is greatly reduced, the problems that the vaccine antigen amount is insufficient, and the production cost is relatively high can be solved, and the research and development process of a bird flu bioreactor cell culture technology is promoted.

Description

technical field [0001] The present invention relates to a method for silencing 2', 5' oligoadenylate synthetase-like (2', 5' oligoadenylate synthetases-like, OASL) gene in DF-1 cell line, which is used to improve the avian influenza virus in the Proliferation titers in cell lines, belonging to the field of biotechnology. Background technique [0002] With the rapid development of intensive breeding industry, important poultry diseases such as avian influenza are becoming the focus of public health security, and controlling diseases from the source is the top priority of the current prevention and control strategy. Practice has proved that vaccine immunization and rapid detection are the most effective measures to prevent and control major animal diseases. Due to the low titer of avian influenza virus cell culture, poultry embryos are still mainly used to produce vaccines in China at present, which has low efficiency, high energy consumption, and the possibility of foreign v...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/867C12N15/54C12N15/113
Inventor 刘存霞亓丽红刘爱玲马秀丽刘华雷宋敏训于可响李玉峰黄兵
Owner POULTRY INST SHANDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap