Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

T3394C kit for detecting Leber disease

A technology of T3394C and mitochondria, which is applied in the field of biotechnology of the Ming Dynasty, can solve the problems of increased false negatives and strict PCR amplification conditions, and achieves the effects of low cost, intuitive result interpretation, and pain relief

Inactive Publication Date: 2015-07-15
ZHEJIANG UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this method can detect positive sites in a short period of time, the PCR amplification conditions are strict, and the probability of false negatives is greatly increased

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • T3394C kit for detecting Leber disease
  • T3394C kit for detecting Leber disease
  • T3394C kit for detecting Leber disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1 A kit of the present invention

[0038] The kit provided by the invention consists of a DNA extraction mixture, a PCR mixture for amplifying T3394C fragments, a pair of outer primers designed for T3394C, a pair of inner primers designed for T3394C, restriction endonucleases, a positive control, and a negative control composition. Among them, the DNA extraction mixture is mainly composed of cell lysate, proteinase K, chloroform, phenol, and absolute alcohol; the PCR mixture for amplifying the T3394C fragment includes dNTP (deoxymononucleotide), 10×PCR buffer, MgCl 2 , triple distilled water and Taq Enzyme (DNA polymerase), a pair of outer primers designed for T3394C has outer forward primer F: TAC TTC ACA AAG CGC CTT CC (SEQ ID NO:1), outer reverse primer R: ATG AAG AAT AGG GCG AAG GG ( SEQ ID NO:2); The internal primers designed for T3394C include internal forward primer F: GCAGAGCCCGGTAATCGCATA (SEQ ID NO:3), internal reverse primer R: GCGAAGGGTTGTAGTAG...

Embodiment 2

[0040] Example 2 Detection of Leber disease families carrying mitochondrial ND1T3394C mutation

[0041] 1. Test samples

[0042] A family with Leber disease carrying the T3394C mutation was selected. See his pedigree image 3 . This family presents a typical maternal inheritance, and the only clinical symptom of the patients is vision loss, but the degree of visual impairment of each affected member in the family varies. The total number of members in this family is 14, including 9 members in the maternal line, and 5 people suffering from Leber's disease.

[0043] 2. Extraction of Genomic DNA

[0044] Samples from 5 subjects were obtained respectively (including the collection of capillaries of III-1 and III-2 and a drop of venous blood filter paper; II-1 and II-2 were oral mucosa scrapings or saliva; hair), cut the blood filter paper into pieces of about 1cm2 with clean scissors, put them into a 1.5ml EP tube (Eppendorf tube), add 900μl red blood cell lysis buffer (20mmo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit, which can rapidly, conveniently, precisely, and economically detect the mitochondrial DNA T3394C mutation related with the LEBER disease. The kit is composed of mixed liquid DNA extracts, a PCR mixed solution containing amplified T3394C sections, a pair of outer primers, a pair of inner primers, restriction endonuclease, positive control and negative control. Genome DNA can be rapidly extract from a blood sample, hairs with hair follicles, an oral mucosa doctor-bar, saliva, or the like, while in a conventional method, DNA must be extracted from the blood of an idiopathic Leber patient, thus the pains of the patient is relieved, the problem of trans-area sample delivering is solved, cleavage specificity is improved, false negative results are avoided, and the stability of detection results is improved. The detection kit is rapid, convenient, precise and economic, and can be applied to large-scale screening and preventive inspection of mtDNA T3394C mutation related with Leber disease.

Description

technical field [0001] The invention belongs to the field of biological technology, and relates to a kit for detecting the mitochondrial DNA T3394C mutation related to Leber's disease, and also relates to a method for detecting the mitochondrial gene mutation related to Leber's disease, in particular to detecting mitochondria ND1 The method for the T3394C mutation, and the application of the above-mentioned method or the above-mentioned kit in detecting the mitochondrial DNA T3394C mutation related to Leber's disease. Background technique [0002] Leber's Hereditary Optic Neuropathy (Leber's Hereditary Optic Neuropathy, LHON, referred to as Leber's disease) is a maternal hereditary optic neuropathy, mainly involving the retina, the anterior part of the scleral cribriform plate macular bundle fibers, leading to maternal genetic disease of optic nerve degeneration , Seriously affecting people's normal production and life. According to the latest statistics from the Ministry o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q2600/156
Inventor 管敏鑫蒋萍萍冀延春梁敏张娟娟
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com