T3394C kit for detecting Leber disease
A technology of T3394C and mitochondria, which is applied in the field of biotechnology of the Ming Dynasty, can solve the problems of increased false negatives and strict PCR amplification conditions, and achieves the effects of low cost, intuitive result interpretation, and pain relief
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1 A kit of the present invention
[0038] The kit provided by the invention consists of a DNA extraction mixture, a PCR mixture for amplifying T3394C fragments, a pair of outer primers designed for T3394C, a pair of inner primers designed for T3394C, restriction endonucleases, a positive control, and a negative control composition. Among them, the DNA extraction mixture is mainly composed of cell lysate, proteinase K, chloroform, phenol, and absolute alcohol; the PCR mixture for amplifying the T3394C fragment includes dNTP (deoxymononucleotide), 10×PCR buffer, MgCl 2 , triple distilled water and Taq Enzyme (DNA polymerase), a pair of outer primers designed for T3394C has outer forward primer F: TAC TTC ACA AAG CGC CTT CC (SEQ ID NO:1), outer reverse primer R: ATG AAG AAT AGG GCG AAG GG ( SEQ ID NO:2); The internal primers designed for T3394C include internal forward primer F: GCAGAGCCCGGTAATCGCATA (SEQ ID NO:3), internal reverse primer R: GCGAAGGGTTGTAGTAG...
Embodiment 2
[0040] Example 2 Detection of Leber disease families carrying mitochondrial ND1T3394C mutation
[0041] 1. Test samples
[0042] A family with Leber disease carrying the T3394C mutation was selected. See his pedigree image 3 . This family presents a typical maternal inheritance, and the only clinical symptom of the patients is vision loss, but the degree of visual impairment of each affected member in the family varies. The total number of members in this family is 14, including 9 members in the maternal line, and 5 people suffering from Leber's disease.
[0043] 2. Extraction of Genomic DNA
[0044] Samples from 5 subjects were obtained respectively (including the collection of capillaries of III-1 and III-2 and a drop of venous blood filter paper; II-1 and II-2 were oral mucosa scrapings or saliva; hair), cut the blood filter paper into pieces of about 1cm2 with clean scissors, put them into a 1.5ml EP tube (Eppendorf tube), add 900μl red blood cell lysis buffer (20mmo...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 