Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection method of Southeast Asian thalassemia

A technology of thalassemia and detection method, which is applied in the field of detection of Southeast Asian thalassemia pathogenic genes, can solve the problems of low sensitivity, complicated operation, and long time consumption, and achieve the effects of high sensitivity, simple operation, and pollution reduction

Active Publication Date: 2015-08-12
赣南医学院第一附属医院
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In order to overcome the shortcomings of low sensitivity, high cost, complicated operation and long time-consuming existing in the existing Southeast Asian thalassemia detection method, the technical problem to be solved by the present invention is to provide a detection method with high sensitivity, low cost and simple operation. , rapid detection method for Southeast Asian thalassemia

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of Southeast Asian thalassemia
  • Detection method of Southeast Asian thalassemia
  • Detection method of Southeast Asian thalassemia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Detection of human peripheral blood SEA thalassemia gene

[0045] a. Design SEA thalassemia-specific LAMP primers and human genome reference LAMP primers, including SEA-FIP, SEA-BIP, SEA-F3, SEA-B3, control-FIP, control-BIP, control-F3, and control-B3 8 primers;

[0046] The designed SEA thalassemia-specific LAMP primers are as follows:

[0047] SEA-F3:CGATCTGGGCTCTGTGTTC

[0048] SEA-B3:TGGAGTGCAGTGTTGTAGTC

[0049] SEA-FIP: GGACGACCGAGTTCCTGCGATTTGAGGGAAGGAGGGGAGAAG

[0050] SEA-BIP: CCTTGGGGAGGTTCACTTGGAGAGCCTTGAACTCCTGGACTT

[0051] The designed human genome reference LAMP primers are as follows:

[0052] control-FIP: ATGCAGAGATATTGCTATTGGCACCATTCTAAAGAATAACAGT

[0053] control-BIP: AGGTTTCATATTGCTAATAGCAGCTTCTTATCCCAACCATAAAATAAAAGC

[0054] control-F3: GATACAATGTATCATGCCTCTT

[0055] control-B3: TGGACTCAGAATAATCCAGC

[0056] b. Sample extraction: extract human blood genomic DNA, extract by Chelex 100 cationic resin (Bio-Rad) adsorption method, take 300 ul...

Embodiment 2

[0070] Sensitivity detection

[0071] Sample extraction: the method is the same as in Example 1.

[0072] Reaction grouping: The extracted SEA positive sample genomic DNA was diluted 10 times and divided into 6 groups, the concentrations were: original sample, 10%, 1%, 0.1%, 0.01%, and negative control. The LAMP reaction and the PCR reaction were performed separately.

[0073] LAMP reaction system, reaction conditions and interpretation criteria: the method is the same as in Example 1. like figure 2 As shown in the results, the original sample, 10%, 1%, 0.1%, and the group all emitted green fluorescence, and the 0.01% group and the negative control group were yellow liquid without green fluorescence. It shows that the sensitivity of the LAMP method is >0.1%.

[0074] PCR reaction system: The PCR reaction system is shown in Table 4. The 10X PCR buffer, 2.5 mM dNTP, and DNA polymerase used were all from Nippon Takara Biotech. SEA-F3 and SEA-B3 were used as PCR primers.

...

Embodiment 3

[0080] Specific detection

[0081] Sample extraction: the method is the same as in Example 1.

[0082] Response grouping: divided into 6 groups, namely SEA thalassemia patients, -3.7 type alpha thalassemia patients, -4.2 type alpha thalassemia patients, -28M type beta thalassemia patients, 41 / 42M type beta thalassemia patients, normal people .

[0083] LAMP reaction system, reaction conditions and interpretation criteria: the method is the same as in Example 1. like Figure 4 As shown, the results showed that the samples of SEA thalassemia patients emitted green fluorescence, and the -3.7 type alpha thalassemia patients, -4.2 type alpha thalassemia patients, -28M type beta thalassemia patients, 41 / 42M type beta thalassemia patients, and normal people all showed It is a yellow liquid without green fluorescence. It shows that this method has no cross-reaction to normal people and samples of other thalassemia types mentioned above, showing good specificity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection method of Southeast Asian thalassemia and particularly relates to a detection method of a disease gene of the Southeast Asian thalassemia. The invention aims to solve the problems that a detection method of the Southeast Asian thalassemia is low in sensitivity, is high in cost, is complex in operation and is long in required time, and provides the detection method of the Southeast Asian thalassemia, which comprises following steps: (A) designing a SEA thalassemia specificity LAMP primer and a human genome internal reference LAMP primer; (B) extracting human blood genome DNA; (C) performing LAMP amplification; and (D) performing detection of an LAMP product. The detection method is good in specificity, is high in sensitivity, is low in cost, is simple in operation, can obtain a result within one hour, can satisfy high-flux sample detection, and is especially suitable for quantitative detection of the SEA thalassemia in inspection department of grassroots units.

Description

technical field [0001] The invention relates to a detection technology of Southeast Asian thalassemia, in particular to a detection method of a Southeast Asian thalassemia pathogenic gene. Background technique [0002] Thalassemia (thalassemia, referred to as: thalassemia) is a group of fatal and disabled hereditary blood diseases that seriously threaten human health. It is named after it was first discovered in the Mediterranean region. Their common feature is that the globin gene defect reduces or fails to synthesize the globin peptide chain in hemoglobin, leading to chronic hemolytic anemia. Thalassemia can be divided into α, β, δ, δβ, γδβ and other types according to the different peptide chains of the synthesis disorder, among which α- and β-thalassemia are the most common. In my country, thalassemia is highly prevalent in the provinces south of the Yangtze River. The detection rate of α-thalassemia gene carriers is 2%-18%, and that of β-thalassemia is 1%-7%. Marriage...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 钟田雨
Owner 赣南医学院第一附属医院