Detection method of Southeast Asian thalassemia
A technology of thalassemia and detection method, which is applied in the field of detection of Southeast Asian thalassemia pathogenic genes, can solve the problems of low sensitivity, complicated operation, and long time consumption, and achieve the effects of high sensitivity, simple operation, and pollution reduction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Detection of human peripheral blood SEA thalassemia gene
[0045] a. Design SEA thalassemia-specific LAMP primers and human genome reference LAMP primers, including SEA-FIP, SEA-BIP, SEA-F3, SEA-B3, control-FIP, control-BIP, control-F3, and control-B3 8 primers;
[0046] The designed SEA thalassemia-specific LAMP primers are as follows:
[0047] SEA-F3:CGATCTGGGCTCTGTGTTC
[0048] SEA-B3:TGGAGTGCAGTGTTGTAGTC
[0049] SEA-FIP: GGACGACCGAGTTCCTGCGATTTGAGGGAAGGAGGGGAGAAG
[0050] SEA-BIP: CCTTGGGGAGGTTCACTTGGAGAGCCTTGAACTCCTGGACTT
[0051] The designed human genome reference LAMP primers are as follows:
[0052] control-FIP: ATGCAGAGATATTGCTATTGGCACCATTCTAAAGAATAACAGT
[0053] control-BIP: AGGTTTCATATTGCTAATAGCAGCTTCTTATCCCAACCATAAAATAAAAGC
[0054] control-F3: GATACAATGTATCATGCCTCTT
[0055] control-B3: TGGACTCAGAATAATCCAGC
[0056] b. Sample extraction: extract human blood genomic DNA, extract by Chelex 100 cationic resin (Bio-Rad) adsorption method, take 300 ul...
Embodiment 2
[0070] Sensitivity detection
[0071] Sample extraction: the method is the same as in Example 1.
[0072] Reaction grouping: The extracted SEA positive sample genomic DNA was diluted 10 times and divided into 6 groups, the concentrations were: original sample, 10%, 1%, 0.1%, 0.01%, and negative control. The LAMP reaction and the PCR reaction were performed separately.
[0073] LAMP reaction system, reaction conditions and interpretation criteria: the method is the same as in Example 1. like figure 2 As shown in the results, the original sample, 10%, 1%, 0.1%, and the group all emitted green fluorescence, and the 0.01% group and the negative control group were yellow liquid without green fluorescence. It shows that the sensitivity of the LAMP method is >0.1%.
[0074] PCR reaction system: The PCR reaction system is shown in Table 4. The 10X PCR buffer, 2.5 mM dNTP, and DNA polymerase used were all from Nippon Takara Biotech. SEA-F3 and SEA-B3 were used as PCR primers.
...
Embodiment 3
[0080] Specific detection
[0081] Sample extraction: the method is the same as in Example 1.
[0082] Response grouping: divided into 6 groups, namely SEA thalassemia patients, -3.7 type alpha thalassemia patients, -4.2 type alpha thalassemia patients, -28M type beta thalassemia patients, 41 / 42M type beta thalassemia patients, normal people .
[0083] LAMP reaction system, reaction conditions and interpretation criteria: the method is the same as in Example 1. like Figure 4 As shown, the results showed that the samples of SEA thalassemia patients emitted green fluorescence, and the -3.7 type alpha thalassemia patients, -4.2 type alpha thalassemia patients, -28M type beta thalassemia patients, 41 / 42M type beta thalassemia patients, and normal people all showed It is a yellow liquid without green fluorescence. It shows that this method has no cross-reaction to normal people and samples of other thalassemia types mentioned above, showing good specificity.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 