Primers, kit and pcr method for detecting m918t site mutation of ret gene
A site mutation and kit technology, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc. High price and other problems, to achieve the effect of avoiding site mismatch, fast detection speed, and high detection sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0116] Example 1: Preparation of wild-type and mutant-type positive plasmids for the mutation of the RET gene M918T site
[0117] Multiple endocrine neoplasia type 2 (MEN2) is caused by mutations in the proto-oncogene RET, which is located on chromosome 10q11. Certain mutations in the RET gene activate RET kinase activity, leading to tumorigenesis or transformation. Clinical evidence shows that the occurrence of more than 90% of multiple endocrine neoplasia type 2 is closely related to the M918T site mutation of the RET gene. Through RET gene mutation screening, carriers of the diseased genotype can be detected early, and effective intervention can be carried out, thereby changing the clinical course of the disease and improving the prognosis.
[0118] First, we called out the gene sequence before and after the M918T mutation site of the RET gene from the gene bank, and marked the polymorphic site with a double underline, at the appropriate position upstream and downstream of...
Embodiment 2
[0135] Example 2: Design and specificity screening of allele-specific primers (ASP)
[0136] For RET-M918T, wild-type and a series of mutant-specific primers were designed as follows:
[0137] RET-M918T-WT-R: caaaaagggattcaattggca (SEQ No. 8)
[0138] RET-M918T-mut-R: caaaaagggattcaattggcg (SEQ No. 9)
[0139] RET-M918T-mut-R1: aaaaagggattcaattggcg (SEQ No. 10)
[0140] RET-M918T-mut-R2: aaaagggattcaattggcg (SEQ No. 11)
[0141] RET-M918T-mut-R3: caaaaagggattcaattgcgg (SEQ No. 12)
[0142] RET-M918T-mut-R4: aaaaagggattcaattgcgg (SEQ No. 13)
[0143] RET-M918T-mut-R5: aaaagggattcaattgcgg (SEQ No. 14)
[0144] RET-M918T-mut-R6: aaagggattcaattgcgg (SEQ No. 15)
[0145] Simultaneously design and synthesize Taqman-specific probes:
[0146] SEQ No. 16: FAM-ccctccttcctagagagttagag-BHQ1.
[0147] Relevant primers and probes were synthesized at Sangon Bioengineering (Shanghai) Co., Ltd.
[0148] Then use the above 8 primers to pair with the common downstream primer RET-M918T-F...
Embodiment 3
[0150] Embodiment 3: ASP sensitivity screening
[0151] Then use the No. 8 mutant primer to pair with the common downstream primer SEQ No.17 of the RET gene M918T mutation site, and use the mutant recombinant plasmid according to 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10, 0 for serial dilution, plus Taqman-specific probes, sensitivity verification was performed on a fluorescent quantitative PCR instrument. The No. 8 mutation-specific primer can detect 100 copies of the mutant, so this primer is the best primer for detecting the RET gene M918T mutation site screened according to our method, as shown in Table 3.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com