Brown planthopper protein translation elongation factor NlEF1gamma, and encoded protein and application thereof

A technology for translation elongation factor and elongation factor, which is applied to the translation elongation factor NlEF1γ of brown lice protein, encoded protein and its application field, and can solve the problems of large difference and low survival rate.

Inactive Publication Date: 2015-08-26
CHINA NAT RICE RES INST
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

And EF-1а is highly conserved, while EF-1γ gene is a single-copy gene, and the difference between different species is relatively large
At present, there are only reports in insects using RNAi technology to silence the EF-1β' gene of Spodoptera exigua, and found that the survival rate at 36 hours after silencing was 58.7%, which was significantly lower than that of the control (Zhao et al., 2012)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brown planthopper protein translation elongation factor NlEF1gamma, and encoded protein and application thereof
  • Brown planthopper protein translation elongation factor NlEF1gamma, and encoded protein and application thereof
  • Brown planthopper protein translation elongation factor NlEF1gamma, and encoded protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Cloning of embodiment 1, NlEF1γ gene, synthesis of dsNlEF1γ

[0041] 1) Cloning of NlEF1γ gene

[0042] Use Qiagen's RNeasy Mini kit (74106) to extract RNA from 5-10 whole brown planthoppers, and use Toyobo's ReverTra AceqPCR RT Kit to synthesize cDNA sequences. 10 μL synthesis system contains 1ng RNA, 2.0 μL 5xRT buffer, and 0.5 μL primer mix , 0.5 μL RT enzyme mix. Incubate at 37°C for 45 minutes, inactivate reverse transcriptase at 98°C for 5 minutes, and dilute the cDNA 10 times as a template for cDNA amplification of the target gene.

[0043] The sequence fragment of the NLEB4403 gene in the NLEBPH EST database was matched with the transcriptome database in our laboratory to obtain the sequence fragment of the NLEBPH NlEF1γ gene, and the upstream primer NlEF1γ-F1324 was designed according to the NCBI primer blast: ATTTCGATCGTGCTCTCTCTCT (SEQ ID NO.3), and the downstream primer NlEF1γ - R1324: GCCTTTCTCAACCCGTTCCC (SEQ ID NO. 4).

[0044] PCR amplification system...

Embodiment 2

[0058] Example 2, the injection experiment of dsNlEF1γ to the 3rd age brown planthopper

[0059] Make agarose gel grooves for fixing N. lugens: prepare agarose gel with a mass concentration of 2.0-2.5%, pour the melted agarose gel into a petri dish with a diameter of 9 cm, the height of the agarose gel is slightly higher than the petri dish, Place 4-5 capillaries with a diameter of 0.5-0.8mm above the Petri dish. After the agarose gel is cooled, remove the capillary to obtain the groove of the agarose gel that can fix the brown planthopper; select 3-4 instar brown planthopper nymphs and blow them into the glass test tube, and use CO 2 After 2 minutes of anesthesia, the brown planthopper was poured into a petri dish filled with agarose gel in advance, and the brown planthopper was neatly placed in the groove of the agarose gel with a soft brush.

[0060] Using an eppendorf microinjector (Model TransferMan NK2, Shanghai Eppendorf Company), each brown planthopper was injected wi...

Embodiment 3

[0061] Example 3: Feeding experiment of dsNlEF1γ to 2nd instar brown planthopper

[0062] Place the glass tube (15cm×2.5cm) with both ends open upright on the ultra-clean workbench, pull the upper end evenly to both sides with a square sealing film, seal the upper open end, and use a pipette to absorb 70.0 μL of artificial feed Drop in the center of the parafilm, the control group only added artificial feed (see Table 1 for the formula), the treatment group added dsRNA (final concentration 50ng / μL) to the artificial feed, used a new parafilm, and stretched the sticker evenly with the sticker facing down. The feed and dsRNA were sealed between two layers of parafilm above the feed-added parafilm.

[0063] Take 30 2nd-instar brown planthoppers with an insect sucker and gently blow them into the glass tube from the open end of the glass tube, and seal the open end with sterilized gauze; each treatment is repeated 10 times; the glass tube with the added feed and blown into the bro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a brown planthopper protein translation elongation factor NlEF1gamma, an encoded protein, synthesized dsRNA, and an application thereof in controlling brown planthopper pest diseases. The gene performs an important function in maintaining the normal growth and development processes of brown planthoppers. When the function is inhibited, brown planthopper nymph growth is slower, brown planthopper nymph size is smaller, and brown planthopper nymph dies because it couldn't develop into adult. When the function of the gene in a brown planthopper female adult is inhibited, its ovaries stop developing and it couldn't spawn normally. According to the invention, brown planthoppers are injected and fed with the dsRNA of the gene fragment. With both means the brown planthopper death rates reach 70% and brown planthopper spawning amounts are 0. Sequence and data bases are provided for establishing novel strategies for controlling pests with an RNA interference technology. The application has significant lethal and ovarian development inhibition effects against brown planthoppers. Therefore, the gene can be sued as an effective target for controlling the pest with an RNAi technology.

Description

(1) Technical field [0001] The invention relates to the brown planthopper protein translation elongation factor NlEF1γ gene, encoded protein and application thereof based on gene silencing technology. (2) Background technology [0002] Rice is one of the most important food crops in the world, and the population that takes rice as a staple food accounts for more than half of the world's population. The brown planthopper (Nilaparvata lμgens) ) (Brown planthopper) directly harms rice by sucking the photosynthetic products of the phloem. In addition, it also spreads rice viruses and causes indirect damage. It is one of the most harmful pests to rice. Therefore, effective control of rice pests is of great significance to increase rice production. [0003] At present, chemical insecticides such as imidacloprid, buprofezin, secbucarb and isoprocarb are the primary method to control the lethality of brown planthopper. It has been improved, and it is reported that its effect on ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435C12N15/12C12N15/11A01N63/02A01P7/04
CPCA01N63/10C07K14/43563
Inventor王渭霞李凯龙赖凤香傅强
OwnerCHINA NAT RICE RES INST