Primers, kit and pcr method for detecting polymorphism of apoe gene
A gene polymorphism and kit technology, applied in the fields of biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem of inability to detect clinical specimens on a large scale at the same time, high price of testing instruments, and low clinical popularity.  and other problems to achieve the effect of avoiding site mismatches, fast detection, and good sensitivity
- Summary
 - Abstract
 - Description
 - Claims
 - Application Information
 
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0133] Example 1: Preparation of wild type and mutant positive plasmids for ApoE gene polymorphism detection
[0134] The human ApoE gene is located on the long arm of chromosome 19, region 13, band 2 (19q132). The full length of the gene is 3.7kb, containing 4 exons and 3 introns, and its cDNA length is 1.163kb. The precursor of ApoE protein consists of 317 amino acids and contains 18 amino acid signal peptides, and the mature ApoE protein consists of 299 amino acids. The ApoE gene has two SNPs, rs429358 and rs7412 located at codons 112 (c.388 T>C) and 158 (c.526 C>T), respectively.
[0135] First, we called out the gene sequence before and after the rs429358 site of the ApoE gene from the gene bank, and marked the polymorphic site with a double underline, at the appropriate position upstream and downstream of the rs429358 site of the ApoE gene (marked in bold and underlined), Design a pair of cloning primers, the amplified fragment is 218bp, including the polymorphic site, ...
Embodiment 2
[0160] Example 2: Design and specificity screening of allele-specific primers (ASP)
[0161] For the rs429358 site of the ApoE gene, wild-type and a series of mutant-specific primers were designed as follows:
[0162] ApoE-rs429358-WT-F: cgcggacatggaggacgagt (SEQ No. 15)
[0163] ApoE-rs429358-mut-F: cgcggacatggaggacgagc (SEQ No. 16)
[0164] ApoE-rs429358-mut-F1:ggacatggaggacgtcc (SEQ No. 17)
[0165] ApoE-rs429358-mut-F2: cggacatggaggacgagc (SEQ No. 18)
[0166] ApoE-rs429358-mut-F3: gcggacatggaggacgtcc (SEQ No. 19)
[0167] ApoE-rs429358-mut-F4: cggacatggaggacgtcc (SEQ No. 20)
[0168] ApoE-rs429358-mut-F5: gcggacatggaggacgagc (SEQ No. 21)
[0169] At the same time, a Taqman-specific probe (SEQ No.22) was designed and synthesized: FAM-ccgcggcgaggtgcaggccatgc-BHQ1. Relevant primers and probes were synthesized at Sangon Bioengineering (Shanghai) Co., Ltd.
[0170] Then use the above 7 primers to pair with ApoE-rs429358-R (SEQ No.23): 5'-cgcagctcctcggtgctctg-3' primers,...
Embodiment 3
[0172] Embodiment 3: ASP sensitivity screening
[0173] We then paired the mutant primers with the ApoE-rs429358-R primers, and used the mutant recombinant plasmids according to 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10, 0 for serial dilution, plus Taqman-specific probes, sensitivity verification was performed on a fluorescent quantitative PCR instrument. Mutant-specific primer No. 7 can detect 100 copies of the mutant, so this primer is the best primer for detecting ApoE polymorphic sites screened according to our method, as shown in Table 3 for details.
[0174] According to the same method, we designed and screened ApoE rs7412 site-specific mutation and wild-type primers, common downstream primers and probes, as shown in Table 3.
PUM
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More - R&D
 - Intellectual Property
 - Life Sciences
 - Materials
 - Tech Scout
 
- Unparalleled Data Quality
 - Higher Quality Content
 - 60% Fewer Hallucinations
 
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



