Engineering bacteria for producing gamma-aminobutyric acid and construction method and application thereof

A technology of GABA and GABA transaminase, which is applied in the field of bioengineering, can solve the problems of waste of resources, safety, and reduction of protein expression in the later stage, and achieve the effects of low cost, avoiding decomposition, and high safety

Active Publication Date: 2015-09-09
SUZHOU RENBEN PHARMA
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] For this reason, the present invention aims at the defects of Bacillus subtilis expression system using plasmids to express exogenous genes in the prior art, resulting in the reduction of protein expression in the later stage, waste of resources and low safety due to the presence of genes for antibiotics and resistant enzymes. A γ-aminobutyric acid-producing engineering bacterium that does not use plasmids to express foreign genes, has stable genetics, high safety, and high-efficiency expression of L-glutamic acid decarboxylase, and its construction method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacteria for producing gamma-aminobutyric acid and construction method and application thereof
  • Engineering bacteria for producing gamma-aminobutyric acid and construction method and application thereof
  • Engineering bacteria for producing gamma-aminobutyric acid and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Construction of L-glutamic acid decarboxylase Bacillus subtilis expression vector pHT01-gadB

[0039] 1. Design primers according to Escherichia coli gadB gene sequence GenBank No: M84025.1, F-gadB-BglII: CAT AGATCT ATGGATAAGAAGCAAGTAAC (shown in SEQ ID NO.1) and R-gadB-XbaI: CGA TCTAGA TCAGGTAGCTTTAAAGCTGTTC (shown in SEQ ID NO.2) has BglII and XbaI sites added to both ends of the primer;

[0040] 2. Using the total DNA of Escherichia coli DH5α strain as a template, the gadB gene fragment was amplified by PCR with the above primers (shown in SEQ ID NO.1-2). The reaction system included: template 1 μL DNA, 1 μL dNTP (10mmol / L) , 2μmol / L MgCl 2 , 0.5 μmol / L primers, 5 μL 10×PCR buffer, 2.5 U KOD DNA polymerase (TOYOBO company). The PCR reaction conditions include: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 53°C for 30 s, extension at 68°C for 2 min, a total of 30 cycles; 10 min at 72°C. The amplified fragment was subje...

Embodiment 2

[0046] Embodiment 2 Construction of integrated knockout vector

[0047] 1. According to the sequence of Bacillus subtilis 168 bacterial strain genome (Genbank No.NC_000964), design primers: upstream primer F-gabTup-BamHI: GCGGGATCCATGACATTTTGAAAACGGTCGAGG (shown in SEQ ID NO.5) and downstream primer R-01gabTup: GATTATGTTACAATAGCTGGTACCGTGAATATCCCCCCTGTCGGTA (SEQ ID NO .6). Using the genomic DNA of the Bacillus subtilis 168 strain as a template, the upstream 1000 bp fragment of the gabT gene cluster was amplified by PCR, and the PCR conditions were the same as those in Example 1 for amplifying the gabT gene fragment.

[0048] 2. Design primers according to the sequence of the vector pHT01-gadB constructed in Example 1, upstream primer F-gabTup01: TACCGACAGGGGGATATTCACGGTACCAGCTATTGTAACATAATC (shown in SEQ ID NO.7) and downstream primer F-01gabTdn: GTCACGCGTCCATGGAGATCTTTCATTGGAAAGAAAATGGCCG (shown in SEQ ID NO.8) . Using pHT01-gadB as a template, a DNA fragment containing the...

Embodiment 3

[0052] Example 3 Integration of L-glutamic acid decarboxylase into the Bacillus subtilis genome

[0053] 1. Transform the pMAD-ΔgabT::gadB plasmid into Bacillus subtilis 168 strain, and coat with X-gal (5-bromo-4-chloro-3-indole-β-D-galactoside) containing 50 μg / mL and erythromycin plate, cultivated overnight at 30 degrees;

[0054] 2. Pick the blue transformants, culture them overnight at 30°C, spread on a plate containing X-gal and erythromycin, and culture them overnight at 42°C;

[0055] 3. Pick a single blue colony and incubate in LB medium at 42°C for 3 hours, spread on a non-resistant LB plate containing X-gal, and culture overnight at 42°C;

[0056] 4. Pick a single colony with white spots and culture it overnight in erythromycin and non-antibiotic LB medium, select a single colony without erythromycin resistance for colony PCR verification, and select F-gabTup-BamHI (SEQ ID NO. 5) and R-gabTdn-XhoI (shown in SEQ ID NO.10), a colony with a size of 3.7 kb can be ampli...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses engineering bacteria for producing gamma-aminobutyric acid and a construction method and application thereof, and belongs to the technical field of bioengineering. The engineering bacteria are obtained by integrating genes of L-glutamic acid decarboxylase and promoters thereof on chromosomes of host bacteria, and the integration loca are located in gamma-aminobutyric acid transaminase genes. The constructed engineering bacteria are good in heredity stability; the expressed L-glutamic acid decarboxylase is high in activity; excess protein expression, especially antibiotic resistant protein expression does not exist, and safety is high. Meanwhile, gamma-aminobutyric acid transaminase of the degradation product gamma-aminobutyric acid is inactivated in the engineering bacteria, so that decomposition of products is avoided in the production process and the yield of products is improved. The raw materials of the engineering bacteria are L-glutamic acid; the gamma-aminobutyric acid is produced efficiently through a biotransformation method, and the produced gamma-aminobutyric acid has no threat of endotoxin pollution, is safe and reliable and can be used in the field of food and heath care products.

Description

technical field [0001] The invention relates to an engineering bacterium producing gamma-aminobutyric acid and its construction and application, belonging to the technical field of bioengineering. Background technique [0002] γ-aminobutyric acid (γ-aminobutyric acid, GABA) is an important inhibitory neurotransmitter widely distributed in animals. It plays an important role and has a regulating effect on various functions of the body, including participating in the production of sedation, analgesic effects, anti-anxiety, prevention and treatment of convulsions, soothing blood vessels and lowering blood pressure, preventing arteriosclerosis, regulating arrhythmia, and regulating the secretion of reproductive physiological hormones Features. It is precisely because of its various physiological functions that γ-aminobutyric acid has a wide range of applications in the fields of medicine, health products, food, and feed additives. In 2009, the Ministry of Health approved γ-ami...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/75C12N15/113C12P13/00C12R1/125
CPCC12N9/88C12N15/75C12P13/005C12Y401/01015
Inventor史吉平柳鹏福
OwnerSUZHOU RENBEN PHARMA