Check patentability & draft patents in minutes with Patsnap Eureka AI!

Plant expression vector of tobacco gibberellin synthetic transcription regulator gene and its application

A technology of transcriptional regulator and plant expression vector, applied in the field of plant genetic engineering, can solve the problems of lack of function, dwarfing plant phenotype, affecting the synthesis of GAs, etc.

Active Publication Date: 2017-12-22
KUNMING UNIV OF SCI & TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Atga3 mutant Arabidopsis thaliana dwarf phenotype due to lack of KO gene and function
The dwarf rice Tan-Ginbozu obtained by natural mutation is a gibberellin-deficient mutant. In the process of GAs synthesis, the steps catalyzed by KO and GA20ox are blocked, which affects the synthesis of GAs, resulting in dwarfing of plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant expression vector of tobacco gibberellin synthetic transcription regulator gene and its application
  • Plant expression vector of tobacco gibberellin synthetic transcription regulator gene and its application
  • Plant expression vector of tobacco gibberellin synthetic transcription regulator gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1: PCR amplification and TA cloning of RSG gene cDNA

[0042] Find the cDNA sequence of the tobacco RSG gene from GenBank, and design a pair of primers with the following sequence:

[0043] Upstream primer 5' GGATCCATGGACCCGAAGTTCAGCGGAAAGC 3' (contains BamHI site)

[0044] Downstream primer 5' CTCGAGTCAACCCCTGTTATTGAAGTTCATG 3' (contains XhoI I site);

[0045] Add a characteristic sequence to the 5' end of the upstream primer, and thus form a BamHI restriction site; add an XhoI I restriction site to the 3' end of the downstream primer, and use the first-strand cDNA of tobacco as a template to amplify to obtain the full-length cDNA of the RSG gene .

[0046] Take 0.2g of treated tobacco leaves (Fresh weight, FW) and freeze them rapidly in liquid nitrogen, use the TRI-ZOL method to roughly extract total RNA according to the instructions of Invitrogen’s TRI-ZOL Reagent, and treat the water with 25 μl DEPC (1 / 1000 ) Dissolve RNA, take 1 μl for electrophoresis...

Embodiment 2

[0049] Example 2: NtRSG entry cloning vector pENTR-2B-NtRSG and plant overexpression vector pK2-35S- RSG build

[0050] TA cloned and sequenced successfully pMD18-T- in Example 1 RSG Carry out BamHI and XhoI double-enzyme digestion with pENTR-2B, which was tested correctly before in the laboratory, and then cut the gel to recover, and subclone the recovered fragment of RSG gene into pENTR by ligase to obtain the entry cloning vector pENTR- RSG , the construction of plant expression vector through Gateway LR reaction technology to construct plant overexpression vector pK2-35S- RSG , The LR reaction plasmid needs to be purified by a plasmid purification kit, and the recombinant vector after successful transformation needs to be screened by Spe (spectinomycin)-resistant LB medium. Build strategies such as figure 2 As shown, the plant expression vector will be recombined and integrated into the tobacco genome through T-DNA insertion, and express the RSG gene. This structure w...

Embodiment 3

[0051] Embodiment 3: the cultivation and screening of Agrobacterium impregnated tobacco and transgenic tobacco

[0052] Using the leaf disc transformation method, using Agrobacterium tumefaciens C58C1 as the medium, transfect tobacco for 15-20 min, and the tobacco explants after successful dipping were placed in MS1 ​​medium (containing 3% sucrose) and co-cultured in the dark for 48 h , and then transferred to MS4 germination medium (containing 3% sucrose, 50 μg / ml kalimycin and 100 μg / ml cephalosporin) to differentiate calli and induce germination. , 12 h light, 200 lx) about 25 days later, the successfully transfected explants will differentiate into transgenic seedlings. Mycin) agarose medium for subculture once to inhibit the growth of Agrobacterium, and subsequent subcultures can be cultured in non-resistant rooting medium MS agarose medium.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant expression vector of a tobacco gibberellin synthetic transcription regulator gene and its application, and belongs to the field of genetic engineering. The invention uses the cDNA of the tobacco synthetic transcription regulator gene RSG to construct a plant expression vector pk2-35S-RSG, And through Agrobacterium-mediated transformation into plants, the plants can improve their tolerance to aluminum stress and overcome the shortcomings of the plant's low resistance to aluminum stress; the experimental results show that the RSG gene, a transcriptional regulator of gibberellin synthesis, is overexpressed in tobacco , enhanced the resistance of tobacco to aluminum stress, and made the root elongation of tobacco almost unaffected under higher concentration of aluminum stress; the significant increase of gibberellin also indicated that RSG overexpressed the transgene under high concentration of aluminum stress Tobacco is more resistant to aluminum than wild type.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, in particular to tobacco gibberellin synthesis transcription regulator gene RSG Plant expression vector and its application in transgenic plants with enhanced ability to alleviate aluminum stress. Background technique [0002] In nature, aluminum usually exists in the form of insoluble silicate or alumina, which is not harmful to plant growth. However, in the process of soil acidification, the pH value of the soil will drop, and when the pH value is lower than 5.0, aluminum ions will be released from the silicate or oxide, and dissolved into the soil, forming Al 3+ form exists. In an acidic soil environment, the insoluble aluminum compound is transformed into dissolved aluminum (Al 3+ ), into the soil to cause toxicity to plants, even micromolar levels of Al 3+ can have serious toxic effects on plants. The toxic effects of aluminum on plants are mainly: affecting normal signal transd...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82A01H5/00
Inventor 陈丽梅熊芸刘蕾杨志丽
Owner KUNMING UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More