Antituberculosis drug and screening method thereof
An anti-tuberculosis and drug technology, applied in biochemical equipment and methods, antibacterial drugs, pharmaceutical formulations, etc., can solve the problems of low ALR inhibitory activity, no obvious improvement in toxicity of DCS structure modification, and human side effects, etc., to achieve good results Anti-tuberculosis activity, low cytotoxicity, broad-spectrum anti-tuberculosis effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] The construction of the expression vector of embodiment 1MTB ALR
[0049] Using the MTB H37Rv genome as a template, using ALR-PF: 5'CGG GAATTC ATGAAACGGTTCTGGGAGAATGTCGGAAAGC3' (SEQ ID NO: 1) and ALR-PR: 5'CAT AAGCTT ACCACGGTTTTTCAGCCTCGCGATAGGTCCT3' (SEQ ID NO: 2) was used as a primer (the underline is the restriction site), and PCR amplification was carried out under the following conditions: pre-denaturation at 95°C for 5 minutes; denaturation at 98°C for 20 seconds, renaturation at 70°C for 15 seconds, and extension at 72°C for 1.5 minutes , 30 cycles; the final reaction at 72 ° C for 8 min. The PCR product was digested with EcoR I and HindIII and ligated with the expression vector pET28a, and transformed into E.coli DH5α. Use the LB plate containing 50mg / L Kanamycin (Kan) to screen positive clones, transform the plasmid with correct sequencing into E.coli BL21(DE3)pLysS, and screen on the LB plate containing 50mg / L Kan to obtain stable ALR protein expressing s...
Embodiment 2
[0051] Expression and purification of embodiment 2MTB ALR
[0052] Pick a single colony in LB liquid medium, culture overnight at 37°C, 200r / min, inoculate in LB medium containing 100mmol / L sorbitol at a ratio of 1:100, and cultivate to OD 600 =0.6. Add IPTG to a final concentration of 20 μmol / L, add lactose to a final concentration of 5 mmol / L, and induce overnight at 16°C and 200 r / min. Collect the cells by centrifugation at low temperature, add lysis buffer [50mmol / L NaH 2 PO 4 , 300mmol / L NaCl, 30mmol / L imidazole, pH8.0], liquid nitrogen-ice water repeated freezing and thawing 5 times, and then use a cell ultrasonic disruptor at 70% energy, 3s / 8s, 100 cycles, 8000× After centrifugation at g for 10 min, the supernatant was collected. Use Ni + The target protein was separated by affinity chromatography column, PLP was added to the final concentration of 0.5mmol / L before loading, and the elution buffer [50mmol / L NaH 2 PO 4 , 300mmol / L NaCl, 500mmol / L imidazole, pH8.0] ...
Embodiment 3
[0054] Example 3 Enzyme activity assay and optimization of screening conditions
[0055] The enzymatic reaction was carried out in a 96-well microtiter plate with a final volume of 100 μl. Enzyme activity assay system includes: 100mmol / L Tris-HCl (pH8.0), 10mmol / L NAD, 0.1U / mL alanine dehydrogenase (Alanine dehydrogenase, ALD), 10mmol / L D-alanine (D-alanine amino acid), 0.3 μg ALR. Under the condition of 37°C, the absorption value of the reaction system at 340nm was detected within 40min (OD 340 )Variety. Wherein DMSO is the solvent of the compound and negative control. Enzyme stability was determined by measuring ALR activity after treatment at temperatures of 4, 25, 30, 34, 37, 42, 48, 52, 58, and 65°C for 30 minutes. The parameters optimized for screening conditions include: reaction temperature (28, 31, 34, 37, 40, 45°C), reaction pH value (2-11, 17 pH values are selected at intervals), reaction substrate NAD (20-0.1625mmol / L, double dilution) and D-alanine (20~0.1...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com