Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Antituberculosis drug and screening method thereof

An anti-tuberculosis and drug technology, applied in biochemical equipment and methods, antibacterial drugs, pharmaceutical formulations, etc., can solve the problems of low ALR inhibitory activity, no obvious improvement in toxicity of DCS structure modification, and human side effects, etc., to achieve good results Anti-tuberculosis activity, low cytotoxicity, broad-spectrum anti-tuberculosis effect

Active Publication Date: 2015-09-30
MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, D-cycloserine (DCS), an anti-tuberculosis drug that acts on ALR, has been used clinically, but the inhibitory activity of DCS on ALR is relatively low, and DCS has relatively large toxic and side effects on the human body [9] , the structural modification of DCS did not significantly improve its toxicity [10-11]

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antituberculosis drug and screening method thereof
  • Antituberculosis drug and screening method thereof
  • Antituberculosis drug and screening method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] The construction of the expression vector of embodiment 1MTB ALR

[0049] Using the MTB H37Rv genome as a template, using ALR-PF: 5'CGG GAATTC ATGAAACGGTTCTGGGAGAATGTCGGAAAGC3' (SEQ ID NO: 1) and ALR-PR: 5'CAT AAGCTT ACCACGGTTTTTCAGCCTCGCGATAGGTCCT3' (SEQ ID NO: 2) was used as a primer (the underline is the restriction site), and PCR amplification was carried out under the following conditions: pre-denaturation at 95°C for 5 minutes; denaturation at 98°C for 20 seconds, renaturation at 70°C for 15 seconds, and extension at 72°C for 1.5 minutes , 30 cycles; the final reaction at 72 ° C for 8 min. The PCR product was digested with EcoR I and HindIII and ligated with the expression vector pET28a, and transformed into E.coli DH5α. Use the LB plate containing 50mg / L Kanamycin (Kan) to screen positive clones, transform the plasmid with correct sequencing into E.coli BL21(DE3)pLysS, and screen on the LB plate containing 50mg / L Kan to obtain stable ALR protein expressing s...

Embodiment 2

[0051] Expression and purification of embodiment 2MTB ALR

[0052] Pick a single colony in LB liquid medium, culture overnight at 37°C, 200r / min, inoculate in LB medium containing 100mmol / L sorbitol at a ratio of 1:100, and cultivate to OD 600 =0.6. Add IPTG to a final concentration of 20 μmol / L, add lactose to a final concentration of 5 mmol / L, and induce overnight at 16°C and 200 r / min. Collect the cells by centrifugation at low temperature, add lysis buffer [50mmol / L NaH 2 PO 4 , 300mmol / L NaCl, 30mmol / L imidazole, pH8.0], liquid nitrogen-ice water repeated freezing and thawing 5 times, and then use a cell ultrasonic disruptor at 70% energy, 3s / 8s, 100 cycles, 8000× After centrifugation at g for 10 min, the supernatant was collected. Use Ni + The target protein was separated by affinity chromatography column, PLP was added to the final concentration of 0.5mmol / L before loading, and the elution buffer [50mmol / L NaH 2 PO 4 , 300mmol / L NaCl, 500mmol / L imidazole, pH8.0] ...

Embodiment 3

[0054] Example 3 Enzyme activity assay and optimization of screening conditions

[0055] The enzymatic reaction was carried out in a 96-well microtiter plate with a final volume of 100 μl. Enzyme activity assay system includes: 100mmol / L Tris-HCl (pH8.0), 10mmol / L NAD, 0.1U / mL alanine dehydrogenase (Alanine dehydrogenase, ALD), 10mmol / L D-alanine (D-alanine amino acid), 0.3 μg ALR. Under the condition of 37°C, the absorption value of the reaction system at 340nm was detected within 40min (OD 340 )Variety. Wherein DMSO is the solvent of the compound and negative control. Enzyme stability was determined by measuring ALR activity after treatment at temperatures of 4, 25, 30, 34, 37, 42, 48, 52, 58, and 65°C for 30 minutes. The parameters optimized for screening conditions include: reaction temperature (28, 31, 34, 37, 40, 45°C), reaction pH value (2-11, 17 pH values ​​are selected at intervals), reaction substrate NAD (20-0.1625mmol / L, double dilution) and D-alanine (20~0.1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an antituberculosis drug disclosed as Formula I and a screening method thereof. An antituberculosis drug screening model is established by using alanine racemase as a target spot; and the model is utilized to screen out the antituberculosis drug with application prospects. The invention also relates to a composition containing the antituberculosis drug disclosed as Formula I and application of the antituberculosis drug disclosed as Formula I in preparing drugs for preventing or treating tuberculosis.

Description

technical field [0001] The invention relates to an anti-tuberculosis drug and an anti-tuberculosis drug screening method, and also relates to a composition containing the anti-tuberculosis drug and the use of the anti-tuberculosis drug for preparing a drug for preventing or treating tuberculosis. Background technique [0002] In recent years, the number of tuberculosis infections has been increasing year by year. In 2012, there were 8.6 million new cases of tuberculosis in the world, and the number of tuberculosis deaths was about 1.3 million. [1] ; China is a country with a high burden of tuberculosis. The increase of multidrug-resistant tuberculosis and HIV-infected cases has made the prevention and control of tuberculosis epidemics face more severe challenges. The rapid development of new anti-tuberculosis drugs to solve the problems faced by tuberculosis treatment has become an urgent task to control the tuberculosis epidemic. [0003] It is the fastest and most effecti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07D235/30A61K31/4184A61P31/06C12Q1/533C12Q1/32
Inventor 肖春玲周爽蒙建州刘忆霜关艳郝雪琴甘茂萝
Owner MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com