anti-tuberculosis drugs

A drug and technology for tuberculosis, applied in the field of anti-tuberculosis drugs, can solve the problems of low ALR inhibitory activity, no obvious improvement of toxicity in DCS structure modification, toxic and side effects of human body, etc., and achieve good anti-tuberculosis activity, low cytotoxicity, and anti-tuberculosis bacteria. Broad spectrum effect

Active Publication Date: 2017-09-01
MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, D-cycloserine (DCS), an anti-tuberculosis drug that acts on ALR, has been used clinically, but the inhibitory activity of DCS on ALR is relatively low, and DCS has relatively large toxic and side effects on the human body [9] , the structural modification of DCS did not significantly improve its toxicity [10-11]

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • anti-tuberculosis drugs
  • anti-tuberculosis drugs
  • anti-tuberculosis drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Construction of expression vector for MTB ALR

[0049] Using MTB H37Rv genome as template, with ALR-PF: 5’CGG GAATTC ATGAAACGGTTCTGGGAGAATGTCGGAAAGC3’ (SEQ ID NO: 1) and ALR-PR: 5’CAT AAGCTT ACCACGGTTTTCAGCCTCGCGATAGGTCCT3' (SEQ ID NO: 2) is the primer (underline is the restriction site), PCR amplification is carried out, and the conditions are: 95°C pre-denaturation for 5min; 98°C denaturation for 20s, 70°C renaturation for 15s, 72°C for extension , 30 cycles; the final reaction at 72°C for 8 min. The PCR product was digested with EcoR I and Hind III and then ligated with the expression vector pET28a and transformed into E.coli DH5α. Screen positive clones on the LB plate containing 50mg / L Kanamycin (Kan), transform the sequenced plasmid into E.coli BL21(DE3)pLysS, and select the stable ALR protein on the LB plate containing 50mg / L Kan Expressed strain. For basic operations, please refer to the Molecular Cloning Experiment Guide [12] .

[0050] Result: The PC...

Embodiment 2

[0051] Example 2 Expression and purification of MTB ALR

[0052] Pick a single colony in LB liquid medium, culture it overnight at 37°C and 200r / min, inoculate it in LB medium containing 100mmol / L sorbitol at a ratio of 1:100, and cultivate to OD 600 = 0.6. Add IPTG to a final concentration of 20μmol / L, add lactose to a final concentration of 5mmol / L, and induce overnight at 16°C and 200r / min. Collect bacteria by centrifugation at low temperature, add lysis buffer [50mmol / L NaH 2 PO 4 , 300mmol / L NaCl, 30mmol / L imidazole, pH 8.0], liquid nitrogen-ice water repeated freezing and thawing 5 times, and then using a cell ultrasonic disruptor at 70% energy, 3s / 8s, 100 cycles of disruption, 8000× Collect the supernatant after centrifugation at g for 10 min. Use Ni + Affinity chromatography column separates the target protein, add PLP to a final concentration of 0.5mmol / L before loading, and use elution buffer [50mmol / L NaH 2 PO 4 , 300mmol / L NaCl, 500mmol / L imidazole, pH 8.0] and lysis...

Embodiment 3

[0054] Example 3 Enzyme activity determination and optimization of screening conditions

[0055] The enzyme activity reaction was carried out in a 96-well microtiter plate with a final volume of 100μl. Enzyme activity determination system includes: 100mmol / LTris-HCl (pH8.0), 10mmol / L NAD, 0.1U / mL alanine dehydrogenase (Alanine dehydrogenase, ALD), 10mmol / L D-alanine (D-alanine) Acid), 0.3μg ALR. Detect the absorbance value (OD) of the reaction system at 340nm within 40min at 37℃ 340 )Variety. Among them, DMSO is the solvent and negative control of the compound. Enzyme stability was measured as the ALR activity after treatment at temperatures of 4, 25, 30, 34, 37, 42, 48, 52, 58, and 65°C for 30 min. The optimized parameters of the screening conditions include: reaction temperature (28, 31, 34, 37, 40, 45°C), reaction pH (2-11, 17 pH values ​​are selected at intervals), reaction substrate NAD (20~0.1625mmol / L, double dilution) and D-alanine (20~0.1625mmol / L, double dilution),...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an antituberculosis drug disclosed as Formula I and a screening method thereof. An antituberculosis drug screening model is established by using alanine racemase as a target spot; and the model is utilized to screen out the antituberculosis drug with application prospects. The invention also relates to a composition containing the antituberculosis drug disclosed as Formula I and application of the antituberculosis drug disclosed as Formula I in preparing drugs for preventing or treating tuberculosis.

Description

Technical field [0001] The present invention relates to anti-tuberculosis drugs and methods for screening anti-tuberculosis drugs. The present invention also relates to a composition containing the anti-tuberculosis drugs and the use of the anti-tuberculosis drugs for preparing drugs for preventing or treating tuberculosis. Background technique [0002] In recent years, the number of tuberculosis infections has been increasing year by year. In 2012, 8.6 million new tuberculosis cases were added globally, and the number of tuberculosis deaths was approximately 1.3 million [1] ; China is a country with a high burden of tuberculosis. The increase in multidrug-resistant tuberculosis and HIV-infected infections has made the prevention and control of tuberculosis epidemics face more severe challenges. The rapid development of new anti-tuberculosis drugs to solve the problems faced by tuberculosis treatment has become a top priority in controlling the tuberculosis epidemic. [0003] It is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07D235/30A61K31/4184A61P31/06C12Q1/533C12Q1/32
Inventor肖春玲周爽蒙建州刘忆霜关艳郝雪琴甘茂萝
OwnerMEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI