Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for rapid detection and genotyping of Mycoplasma pneumoniae

A technology for Mycoplasma pneumoniae and genotyping, applied in the field of microbial detection, can solve the problems of difficulty in culturing Mycoplasma pneumoniae specimens, restricting the research and development of Mycoplasma pneumoniae, asynchronous detection time limit, etc., and achieves good clinical application prospects, saving manpower, and operating conditions. Not harsh effect

Active Publication Date: 2017-11-07
ICDC CHINA CDC
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although the commonly used Mycoplasma pneumoniae typing techniques reported above have been widely used, they have obvious defects: these methods all rely on the isolation and culture of Mycoplasma pneumoniae, that is, after the Mycoplasma pneumoniae strains are isolated from the specimens, they are purified and purified. Genotyping can only be performed after culturing and extracting high-concentration Mycoplasma pneumoniae genomic DNA, and the amount of Mycoplasma pneumoniae nucleic acid in ordinary clinical specimens is not enough to support the detection by the above-mentioned typing method
This situation has led to a serious disconnection between the detection technology and the typing technology of Mycoplasma pneumoniae: after nucleic acid extraction, the rapid detection of Mycoplasma pneumoniae is carried out by fluorescent PCR technology (the test result can be obtained within 1 hour), but the typing needs to be determined first. The specimens were isolated and cultured for Mycoplasma pneumoniae strains, and the positive specimens could be tested by common typing methods after nucleic acid extraction (the typing results could be obtained after an average of 2 weeks), and the culture of Mycoplasma pneumoniae specimens was very difficult and the positive rate was low, resulting in Many positive specimens detected by fluorescent PCR cannot be isolated and cultured for strains and cannot be tested for typing, which makes the typing results biased to a certain extent
The inconsistency between the detection sensitivity of Mycoplasma pneumoniae and genotyping detection, and the asynchronous detection time limits have seriously restricted the development of Mycoplasma pneumoniae research.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for rapid detection and genotyping of Mycoplasma pneumoniae
  • Kit for rapid detection and genotyping of Mycoplasma pneumoniae
  • Kit for rapid detection and genotyping of Mycoplasma pneumoniae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Determination of target sequences for detection and genotyping of Mycoplasma pneumoniae

[0053] 20 clinical isolates of different types of domestic Mycoplasma pneumoniae were selected for enrichment culture, and the DNA of the whole bacteria was extracted. After the concentration was determined, the whole genome was sequenced using the Illumina Hiseq 2000 sequencer. The sequenced strains and the complete genome sequences of 8 strains of Mycoplasma pneumoniae known in the NCBI database [M129 (GenBank: U00089.2); FH (GenBank: CP002077.1); 309 (GenBank: AP012303.1); M29 (GenBank: CP008895 .1); M129-B7 (GenBank: CP003913.2); PO1 (GenBank: ANAA00000000.1); 19294 (GenBank: ANIQ00000000.1); PI1428 (GenBank: ANAB00000000.1)] using Mauve software for whole genome sequence comparison Yes, find out the specific nucleic acid sequence regions of type 1 strain and type 2 strain: there is a sequence-specific nucleotide fragment of about 3kbp in the genome of type 1 strain, ...

Embodiment 2

[0054] Example 2 Design of primers and probes for target sequences

[0055] The target sequences of the Mycoplasma pneumoniae type 1 and type 2 strains obtained in Example 1 were analyzed, the highly conserved regions were selected, and probes and primers suitable for dual fluorescent PCR were designed using Primer Express Version 3 software. The probe type is TaqMan probe, the probe for detecting type 1 strains is 5' labeled with the fluorescent group FAM, the 3' is labeled with the quencher group BHQ1, and the probe for detecting type 2 strains is 5' labeled with the fluorescent group VIC, 3' Label the quencher group BHQ1.

[0056] The primer and probe sequences are as follows:

[0057] MP 1-F: CCAGATTCACGTTTAATTTC

[0058] MP 1-R: GCATCTAACATGAAGACTG

[0059] MP 1-P: FAM-AACCAACAACTTCTCATTCATCCTCAG-BHQ1

[0060] MP 2-F:TTGGGTAAACCTAATTTGC

[0061] MP 2-R:ACACGTATTAGCATCACTA

[0062] MP 2-P: VIC-AAGACTATTCGCCTTACAACCAACC-BHQ1.

Embodiment 3

[0063] Example 3 Optimization and method establishment of dual fluorescent PCR condition parameters for detection and genotyping of Mycoplasma pneumoniae

[0064] (1) Optimization of magnesium ion concentration in the system: MgCl in the system 2 Increase from 0.5 μl to 4 μl successively, each increment of 0.5 μl, and make 3 parallel samples for each concentration gradient. ResultMgCl 2 The amount added is 1.5 μl (MgCl 2 The amplification effect of the system is the best when the final concentration is 4mM).

[0065] (2) Optimization of the annealing temperature of the system: the annealing temperature of the system was changed from 55°C to 65°C, and the results showed that the amplification effect of the system was the best when the annealing temperature was 55°C to 57°C.

[0066] (3) Establishment of dual real-time fluorescent quantitative PCR method for detection and genotyping of Mycoplasma pneumoniae

[0067]

[0068]

[0069] For the above primers and probes, r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a kit for rapid detection and genotyping of Mycoplasma pneumoniae, which belongs to the technical field of microbial detection. The kit contains 2 pairs of specific primer pairs and 2 probes used in conjunction with the primer pairs. The nucleotide sequences are as follows: As shown in SEQ ID No.1-6, the dual fluorescent quantitative PCR method is used to realize rapid detection and genotyping of Mycoplasma pneumoniae, the detection sensitivity is 3 CFU, and the accuracy of genotyping is 100% consistent with the commonly used genotyping methods , the sensitivity of typing is much higher than that of commonly used culture-dependent typing techniques, which greatly shortens the typing time, and enables genotyping while detecting Mycoplasma pneumoniae in samples, overcoming the current typing method of Mycoplasma pneumoniae It has the disadvantages of low sensitivity, laborious work and high cost, but it has good detection and typing capabilities of actual specimens and is suitable for popularization and application.

Description

technical field [0001] The invention relates to the technical field of microorganism detection, in particular to a kit for rapid detection and genotyping of Mycoplasma pneumoniae. Background technique [0002] Mycoplasma pneumoniae (Mycoplasma pneumoniae, Mp) is one of the important pathogens causing human respiratory tract infection, and about 10%-40% of community-acquired pneumonia is caused by its infection every year. Fluorescent PCR detection technology has gradually become the gold standard for the detection of Mycoplasma pneumoniae infection by virtue of its advantages of rapidity, high sensitivity and specificity, and has been widely used in clinical testing and scientific research. Genotyping Mycoplasma pneumoniae on the basis of detection is an important monitoring method for in-depth understanding of its antigenic variation and early warning and prediction of strain epidemic outbreaks. Studies have found that Mycoplasma pneumoniae can be divided into two types of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCC12Q1/686C12Q1/689C12Q2600/166C12Q2561/101C12Q2545/114C12Q2531/113C12Q2537/143C12Q2545/101C12Q2563/107
Inventor 赵飞张建中刘立雍陶晓霞何利华孟凡亮顾一心肖迪张慧芳胡源
Owner ICDC CHINA CDC