Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for constructing Salmonella typimurium S496, obtained strain thereof and application thereof

A technology of Salmonella typhi, construction method, applied in microorganism-based methods, biochemical equipment and methods, medical preparations containing active ingredients, etc., can solve the problem of unsatisfactory attenuation effect, bacterial resistance, and bacterial Immune response level, etc.

Inactive Publication Date: 2015-12-09
SICHUAN AGRI UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, for Salmonella typhimurium, deletion alone wxya gene or wxya Gene, not only the attenuation effect is not satisfactory, but more importantly, if the synthesis of LPS or ECA is blocked, the resistance of the attenuated strain to the survival pressure from the host body will decrease, which will seriously affect the level of bacterial immune response; and if wxya and wxya After the double deletion of the gene, neither LPS nor ECA can be synthesized, and the resistance of the bacteria to the survival pressure from the host body will be seriously affected

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing Salmonella typimurium S496, obtained strain thereof and application thereof
  • Method for constructing Salmonella typimurium S496, obtained strain thereof and application thereof
  • Method for constructing Salmonella typimurium S496, obtained strain thereof and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] 1,? wxya Primer design

[0069] According to the whole genome sequence of Salmonella typhimurium UK-1 published by Genbank (sequence number: CP002614), two pairs of primers were designed to amplify wxya The upper and lower homology arms of the gene have amplified fragment sizes of 410bp and 497bp respectively. The above primers were synthesized by Beijing Huada Gene Company. The primer sequences are as follows:

[0070] D. wxya -1F: 5'CATAGAGCAGCTTTTGCATG3'

[0071] D. wxya -1R: 5'GTCCTTCATATTTTTCTATTCCATAAGGCGTA3'

[0072] D. wxya -2F: 5'GAATAGAAAATATGAAGGACGCCAGTAATG3'

[0073] D. wxya -2R: 5'GCGAAATTATTGCCCTTACC3'

[0074] 2, wxya Amplification and fusion of the upper and lower homology arms of the gene

[0075] Pick a single colony of Salmonella typhimurium S100 and culture it overnight in 5mL LB liquid medium (37°C, 180rpm), and use the bacterial genome extraction kit from Tiangen Biochemical Technology Co., Ltd. to extract the genome according to the o...

Embodiment 2

[0087] 1,? wxya Primer design

[0088] According to the whole genome sequence of Salmonella typhimurium S100 published by Genbank (sequence number: CP002614), two pairs of primers were designed to amplify wxya The upper and lower homology arms of the gene, the amplified fragment sizes are 398bp and 376bp respectively, superior The above primers were synthesized by Beijing Huada Gene Company, and the primer sequences are as follows:

[0089] D. wxya -1F: 5'CGACGGCAAACCGCACTGGG3'

[0090] D. wxya -1R: 5'CTGCCGTTTTATCAGCGCCAGACTCCTTTGG3'

[0091] D. wxya -2F: 5'CTGGCGCTGATAAACGGCAGGTTCTTACTC3'

[0092] D. wxya -2R: 5'GCGTTGCCACGCCTGCAGTG3'

[0093] 2, wxya Amplification and fusion of the upper and lower homology arms of the gene

[0094] Pick a single colony of Salmonella typhimurium S100 and culture it overnight in 5mL LB liquid medium (37°C, 180rpm), and use the bacterial genome extraction kit from Tiangen Biochemical Technology Co., Ltd. to extract the gen...

Embodiment 3

[0106] S100Δ wxya Δ wxya Construction and identification of mutant strains

[0107] will carry the suicide plasmid pYA4278- wxya lambda pir Escherichia coli and Salmonella typhimurium S100Δ wxya Carry out conjugative transfer, screen positive colonies on chloramphenicol-resistant LB plates, culture and proliferate positive colonies in LB liquid medium without chloramphenicol resistance, screen sucrose-resistant colonies on 10% sucrose plates, and Single colonies were picked for PCR identification.

[0108] Identification: Use the colony to be tested as a template and use primer D wxya -1F / D wxya -2R and D wxya -1F / D wxya -2R for PCR amplification. Strain deletion wxya after primer D wxya -1F / D wxya The size of the -2R amplification product is the fusion homology arm wxya -UD size (897bp), if the deletion is not successful, the PCR product band size is 1974bp; the strain is deleted wxya After gene, primer D wxya -1F / D wxya The -2R ampl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides Salmonella typimurium S496. The Salmonella typimurium S496 is characterized by lacking an rfbB gene and an rffG gene; a pagL gene is replaced by an arabinose-regulatory-sequence-containing rfbB gene with a changed SD sequence and a changed initiation codon, and the nucleotide sequence of the arabinose-regulatory-sequence-containing rfbB gene with the changed SD sequence and the changed initiation codon is shown as SEQ ID No.1; the classification of the attenuation strain is named as the Salmonella typimurium S496, the Salmonella typimurium S496 is collected in the China Center For Type Culture Collection (CCTCC), the collection number is CCTCC M2015562, and the collection time is September 21st, 2015. The invention further provides a method for constructing the Salmonella typimurium S496. Meanwhile, the invention provides an application of the strain or the attenuation strain constructed with the construction method in vaccine.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a method for constructing attenuated Salmonella typhimurium and the resulting strain and application; in particular, it relates to a mutant strain of Salmonella typhimurium that uses arabinose to simultaneously regulate the synthesis of LPS and ECA and a method for constructing the same. Background technique [0002] Lipopolysaccharide (LPS) is an important virulence factor of bacteria, which is directly related to the ability of pathogenic bacteria to infect the body. Enterobacterial Common Antigen (ECA) is a glycolipid structure shared by members of the Enterobacteriaceae family, which plays an important role in the acidic environment of the host body, bile salt resistance, pustule formation, and virulence of different bacteria. , It also affects the ability of pathogenic bacteria to infect the body. Previous studies have shown that truncating the O antigen on Salmon...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/74A61K39/112A61P31/04C12R1/42
Inventor 孔庆科黄春赵新新刘青
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com