Unlock instant, AI-driven research and patent intelligence for your innovation.

System for rapidly analyzing RNA (ribonucleic acid) functional element in vivo and application of system

A functional element and rapid analysis technology, applied in the field of genetic engineering, can solve problems such as the inability to quickly find cis-acting elements

Inactive Publication Date: 2016-01-20
PEKING UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a system for rapid analysis of RNA functional elements in vivo, to solve the problem of the inability to quickly find functional cis-acting elements in the mRNA 3'UTR in plants in the prior art, and to detect the pairing of internal and external signals and effector proteins. The Regulatory Problem of Cis-acting Elements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • System for rapidly analyzing RNA (ribonucleic acid) functional element in vivo and application of system
  • System for rapidly analyzing RNA (ribonucleic acid) functional element in vivo and application of system
  • System for rapidly analyzing RNA (ribonucleic acid) functional element in vivo and application of system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] This embodiment provides a system for rapidly analyzing RNA functional elements in the body. figure 1 The pCAMBIA2335 vector shown was transformed, and its resistance gene NPTII was cut out with restriction enzyme XhoI and connected to mCherry fluorescent protein gene; in the multiple cloning site, KpnI and XbaI were linked to GFP Fluorescent protein gene, so that the two fluorescent proteins are driven by two different 35S strong promoters on the same vector, forming a dual fluorescent reporter vector, named pCAMBIA2335mG, or p35mG for short. figure 2 Shown.

[0031] The specific method of constructing the vector is as follows:

[0032] 1. Primer

[0033] Amplify mCherry:

[0034] Forward primer

[0035] tctctcgagctttcgcagatctgtcgatcgaccatggtgagcaagggcgaggaggataacatggccatcatcaaggagttc

[0036] Reverse primer agcctcgagtcacttgtacagctcgtccatgccgccggtggag

[0037] Amplify GFP:

[0038] Forward primer gtcggtaccatggtgagcaagggcgag

[0039] Reverse primer ttatctagatccggtggatccaagcttc

[00...

Embodiment 2

[0088] This embodiment provides a system for rapidly analyzing RNA functional elements in vivo, which can accurately identify fragments that respond to ethylene signals and mediate translation inhibition.

[0089] The classic ethylene reaction is the well-known triple reaction. When ethylene is applied, the chlorotic seedlings show that the hypocotyl becomes shorter and thicker, the root becomes shorter, and the apical hook becomes more intense. Previous studies have found that transgenic plants (G1U) overexpressing EBF1 full-length 3'UTR, grown on a medium containing 10μMACC (a precursor of ethylene biosynthesis) for 3 days, have a clear ethylene-insensitive phenotype. , Its hypocotyl length and root length are significantly longer than that of the wild type, and the apical hook disappears, which has been disclosed in Chinese Patent No. ZL201110110101.0.

[0090] Similarly, when we overexpress the above-mentioned fragments proved to have translational inhibition function by the de...

Embodiment 3

[0095] This embodiment provides a system for rapidly analyzing RNA functional elements in vivo, which can detect the inhibitory effect of effector proteins on RNA translation.

[0096] The system for rapid analysis of RNA functional elements in vivo provided in this example can detect fragments that respond to ethylene signals and mediate translational inhibition, and the conclusion drawn is consistent with the phenotype of 3'UTR fragment overexpression in Arabidopsis. Therefore, this system can be widely used in plants to quickly analyze RNA functional elements, and can detect the regulatory effects of different signals on 3'UTR.

[0097] In the tobacco transient expression system of this embodiment, multiple Agrobacterium containing different plasmids can be transferred simultaneously, so this system can also be used to study the regulation of effector proteins on RNA. It is known that EIN5 (EthyleleInsensitive5, Potuschaketal., PlantCell, 2006; Olmedoetal., PNAS, 2006) is known ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a system for rapidly analyzing an RNA (ribonucleic acid) functional element in vivo. The system comprises a bifluorescence reporter vector p35mG, and the vector comprises a coding sequence shown as SEQ ID No.1. Through establishment of the bifluorescence reporter vector p35mG with the coding sequence shown as the SEQ ID No.1, one fluorescent protein mCherry is taken as internal reference, the other fluorescent protein GFP is taken as a reporter gene, a to-be-detected gene segment is inserted into GFP coding sequence to form a recombinant reporter gene GFP-3'UTR, and the functional cis acting element in the RNA is rapidly identified by analyzing influence of different segments on fluorescence intensity ratio of GFP to mCherry; besides, the regulation process of the cis acting element can be controlled through application of different treatment or expression of different effector proteins, and accordingly, the regulation effect of different signals or effector proteins in plants on the RNA is studied.

Description

Technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a system for rapidly analyzing RNA functional elements in vivo. Background technique [0002] There are a variety of regulatory elements on the 3'UTR (3'Un-TranslatedRegion) of eukaryotic mRNA, which can specifically recruit various miRNAs and RNA-binding proteins, thereby regulating mRNA degradation, translation, and subcellular localization (Chatterjeeetal., Biology of the Cell, 2009; Mayrand Bartel, Cell, 2009; Szostak and Gebauer., Briefing in Functional Genomics, 2012). The 3'UTR of eukaryotic mRNA is generally a long sequence, and those functional regulatory elements are hidden in it. At present, scientific research still lacks an efficient and convenient system for analyzing the functional elements of mRNA 3'UTR. [0003] Some researchers transferred a vector into human cells and used a bidirectional promoter to initiate gene transcription of GFP and mCherry respecti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12Q1/68
Inventor 郭红卫马梦迪
Owner PEKING UNIV