System for rapidly analyzing RNA (ribonucleic acid) functional element in vivo and application of system
A functional element and rapid analysis technology, applied in the field of genetic engineering, can solve problems such as the inability to quickly find cis-acting elements
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] This embodiment provides a system for rapidly analyzing RNA functional elements in the body. figure 1 The pCAMBIA2335 vector shown was transformed, and its resistance gene NPTII was cut out with restriction enzyme XhoI and connected to mCherry fluorescent protein gene; in the multiple cloning site, KpnI and XbaI were linked to GFP Fluorescent protein gene, so that the two fluorescent proteins are driven by two different 35S strong promoters on the same vector, forming a dual fluorescent reporter vector, named pCAMBIA2335mG, or p35mG for short. figure 2 Shown.
[0031] The specific method of constructing the vector is as follows:
[0032] 1. Primer
[0033] Amplify mCherry:
[0034] Forward primer
[0035] tctctcgagctttcgcagatctgtcgatcgaccatggtgagcaagggcgaggaggataacatggccatcatcaaggagttc
[0036] Reverse primer agcctcgagtcacttgtacagctcgtccatgccgccggtggag
[0037] Amplify GFP:
[0038] Forward primer gtcggtaccatggtgagcaagggcgag
[0039] Reverse primer ttatctagatccggtggatccaagcttc
[00...
Embodiment 2
[0088] This embodiment provides a system for rapidly analyzing RNA functional elements in vivo, which can accurately identify fragments that respond to ethylene signals and mediate translation inhibition.
[0089] The classic ethylene reaction is the well-known triple reaction. When ethylene is applied, the chlorotic seedlings show that the hypocotyl becomes shorter and thicker, the root becomes shorter, and the apical hook becomes more intense. Previous studies have found that transgenic plants (G1U) overexpressing EBF1 full-length 3'UTR, grown on a medium containing 10μMACC (a precursor of ethylene biosynthesis) for 3 days, have a clear ethylene-insensitive phenotype. , Its hypocotyl length and root length are significantly longer than that of the wild type, and the apical hook disappears, which has been disclosed in Chinese Patent No. ZL201110110101.0.
[0090] Similarly, when we overexpress the above-mentioned fragments proved to have translational inhibition function by the de...
Embodiment 3
[0095] This embodiment provides a system for rapidly analyzing RNA functional elements in vivo, which can detect the inhibitory effect of effector proteins on RNA translation.
[0096] The system for rapid analysis of RNA functional elements in vivo provided in this example can detect fragments that respond to ethylene signals and mediate translational inhibition, and the conclusion drawn is consistent with the phenotype of 3'UTR fragment overexpression in Arabidopsis. Therefore, this system can be widely used in plants to quickly analyze RNA functional elements, and can detect the regulatory effects of different signals on 3'UTR.
[0097] In the tobacco transient expression system of this embodiment, multiple Agrobacterium containing different plasmids can be transferred simultaneously, so this system can also be used to study the regulation of effector proteins on RNA. It is known that EIN5 (EthyleleInsensitive5, Potuschaketal., PlantCell, 2006; Olmedoetal., PNAS, 2006) is known ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 