Genetic transformation method for panicum virgatum L.

A technology of genetic transformation and willow branch, which is applied in the field of plant bioengineering, can solve the problems that the genetic transformation system has not yet been established and low efficiency, and achieve the effects of ensuring continuous sufficient supply, reducing costs, and high transformation efficiency

Inactive Publication Date: 2016-02-03
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the switchgrass genetic transformation systems reported so far have an efficiency of less than 10%.
In addition, most of the previously reported transgenic switchgrass plants were obtained by hygromycin selection, and a few were produced by bialaphos selection, but a switchgrass genetic transformation system using kanamycin for selection has not yet been established

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic transformation method for panicum virgatum L.
  • Genetic transformation method for panicum virgatum L.
  • Genetic transformation method for panicum virgatum L.

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: The acquisition and propagation of switchgrass type II high-quality embryogenic callus comprises the following steps:

[0037] 1) After sterilizing the mature seeds of switchgrass with 3% (W / V) calcium hypochlorite for 2 hours, wash them with sterile distilled water 3 times (5 minutes each time), then put them in the refrigerator at 4°C overnight, and continue to use them the next day Disinfect with 5% (W / V) calcium hypochlorite for 1.5 hours, then wash 3 times with sterile distilled water (5 minutes each time), inoculate on callus induction medium (MSD5), and treat each seed Numbering, incubator temperature 25±2°C, dark culture for 6-7 weeks, to obtain callus.

[0038] 2) The callus obtained in step (1) was visually selected to be type II high-quality embryogenic callus with light yellow, loose structure and warm luster ( figure 1 ), inoculated on MSD5 medium, preserved and multiplied, the temperature of the incubator was 25±2°C, cultured in the dark, su...

Embodiment 2

[0041] Example 2: The main features of the acquisition of transgenic switchgrass plants include the following steps:

[0042] 1) Store the pMDC100 binary vector ( figure 2 A) Agrobacterium tumefaciens AGL1 Streak inoculation on LB solid medium supplemented with 50mg / L rifampicin and 50mg / L kanamycin, culture overnight at 28°C, then pick a single colony and inoculate in LB supplemented with 50mg / L rifampicin and 50mg / L kanamycin In the liquid medium of mycin, cultivate overnight at 28°C on a shaker (200rpm) to OD 600 reach 0.6, then add acetosyringone to a final concentration of 200 μmol / L, and continue culturing for 2 h to OD 600 Reach 0.8-1.0, 3500rpm, centrifuge at 20°C for 15 minutes to collect the Agrobacterium cell pellet, and use MS3D liquid medium to resuspend the cell to adjust the OD 600 to 0.3.

[0043] 2) Use the Agrobacterium strain prepared in step (1) to co-incubate the high-quality embryogenic callus of switchgrass type II described in Example 1 for 10 m...

Embodiment 3

[0055] Example 3: Molecular identification of transgenic switchgrass plants obtained by kanamycin resistance screening, its main features include the following steps:

[0056] From the transgenic switchgrass plants grown in the greenhouse for 1 month, the top 8-9cm leaves were taken and cut into 3-4cm segments, and the 2×CTAB method was used (Zhang Xiaoxiang et al., A modified CTAB method for rapid extraction of wheat genomic DNA, China Agricultural Science Bulletin, 2012,28:46-49) extract DNA, and perform exogenous gene ( nptII ) PCR amplification to identify positive transgenic switchgrass plants ( image 3 ).

[0057] Described for exogenous gene ( nptII ) The PCR primer sequence of detection is:

[0058] nptIIF: CGTCCTTTGCTCGGAAGAGTATGAA

[0059] nptIIR: GACGCAGAAGGCAATGTCATACCAC

[0060] The amplification condition of PCR is: 95° C., 2 min; followed by 30 cycles, and the condition of each cycle is . 94°C, 30s; 55°C, 30s; 72°C, 30s; finally 72°C, 10min.

[0061]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetic transformation method for panicum virgatum L., and belongs to the technical field of plant bioengineering. The method comprises disinfection of mature panicum virgatum L. seeds, induction and propagation expanding of type II high-quality embryonic callus, kanamycin screening to obtain kanamycin-resistant callus tissue after agrobacterium infection, kanamycin-resistant callus tissue regeneration and rooting, and finally acquisition of positive transgenic panicum virgatum L. plants. The method is mainly used for solving the problems of large-scale screening and commercialized production of transgenic panicum virgatum L.. Experimental data show that by the adoption of the method, low-cost kanamycin can be used as a transgenic plant resistance screening reagent, the positive transgenic panicum virgatum L. plants are successfully obtained in 4-5 months, genetic transformation efficiency reaches up to 60%, 100 genetic vectors can be transformed by each person every year, and the working efficiency of producing more than 2,000 independent positive transgenic panicum virgatum L. plants is achieved.

Description

technical field [0001] The invention belongs to the technical field of plant bioengineering, in particular to a method for genetic transformation of plants, in particular to a method for genetic transformation of switchgrass. Background technique [0002] Cellulose biomass resources are the most abundant raw materials on the earth, but due to the lack of some key technologies, less than 1% of the cellulosic biomass resources that can be used for energy production are currently available. Genetic engineering breeding can quickly overcome the genetic barriers between species, so as to cultivate new energy grass resources with high yield, stress resistance and high efficiency conversion in a short period of time. Therefore, adopting the strategy of genetic engineering to excavate and identify the key genetic resources that can determine the biomass, quality and stress resistance of energy grasses, and to obtain corresponding genetically improved plants will help solve the probl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82A01H5/00
Inventor付春祥吴风燕马利超曹英萍周功克
OwnerQINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI