Use of human uba2 gene and related medicines
A kind of use and drug technology, applied in the direction of drug combination, gene therapy, genetic engineering, etc., can solve the problem that the role of UBA2 has not been reported.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0079] Example 1 Preparation of RNAi lentivirus against human UBA2 gene
[0080] 1. Screening for effective siRNA targets against human UBA2 gene
[0081] Retrieve UBA2 gene information from Genbank; design effective siRNA targets for UBA2 gene. Table 1 lists one of the effective siRNA target sequences for UBA2 gene.
[0082] Table 1 siRNA target sequence targeting human UBA2 gene
[0083] SEQ ID NO TargetSeq 1 GCCCGAAACCATGTTAATAGA
[0084] 2. Preparation of lentiviral vector
[0085] Aim at the siRNA target (taking SEQ ID NO: 1 as an example) to synthesize a double-stranded DNA Oligo sequence (Table 2) with Age I and EcoR I restriction endonucleases at both ends; use Age I and EcoR I restriction enzyme Act on the pGCSIL-GFP carrier (provided by Shanghai Jikai Gene Chemical Technology Co., Ltd., figure 1 ), to linearize it, and identify the digested fragments by agarose gel electrophoresis.
[0086] Table 2 Double-stranded DNA Oligo with sticky end...
Embodiment 2
[0106] Example 2 Real-time fluorescent quantitative RT-PCR method to detect the silencing efficiency of UBA2 gene
[0107] Colon cancer RKO cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, RKO: 10) value, an appropriate amount of the virus prepared in Example 1 was added, the culture medium was replaced after 24 hours of culture, and the cells were collected after the infection time reached 5 days. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV instruction manual of Promega Company, RNA was reverse-transcribed to obtain cDNA (see Table 7 for the reverse transcription reaction system, react at 42° C. for 1 h, and then bathe in a water bath at 70° C. for 10 min to inactivate reverse transcriptase)...
Embodiment 3
[0115] Example 3 Detection of proliferation ability of tumor cells infected with UBA2-siRNA lentivirus
[0116] Colon cancer RKO cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, RKO: 10), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 4 days, the cells of each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 2000 / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the plate was detected and read once a day with a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More