Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

LAMP primer pair used for I subgroup fowl adenovirus detection and detection method thereof

A technology of poultry adenovirus and detection method, applied in the field of poultry adenovirus detection, achieves good safety, high sensitivity, and easy-to-observe effect

Active Publication Date: 2016-05-25
乾元浩生物股份有限公司
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, so far, no LAMP detection technology capable of sensitive and specific detection of subgroup I avian adenovirus has been developed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP primer pair used for I subgroup fowl adenovirus detection and detection method thereof
  • LAMP primer pair used for I subgroup fowl adenovirus detection and detection method thereof
  • LAMP primer pair used for I subgroup fowl adenovirus detection and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] 1 Test materials and methods

[0033] 1.1 Main reagents

[0034] 12 serotypes of subgroup I avian adenovirus standard strains avian adenovirus type 1 to type 12 were purchased from the China Veterinary Drug Administration, egg drop syndrome virus (EDSV), avian reovirus (ARV), poultry Infectious bursal disease virus (IBDV), avian infectious bronchitis virus (IBV), Newcastle disease virus (ND), avian adenovirus isolate (FAdV), etc., are all conventional strains in the field preserved in the laboratory .

[0035] DNA constant temperature amplification kit was purchased from Anjieyou Technology Co., Ltd.; EasyPureViralDNA / RNAKit was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; SYBRGreenI was purchased from Invitrogen; Calcein was purchased from Japan Rongyan Company.

[0036] 1.2 Primer design

[0037] 6 primers were designed for the conserved region of the I subgroup avian adenovirus hexo gene, which were outer primers (FAdV-F3 (shown in SEQIDNo.1) and FAd...

Embodiment 2

[0050] Embodiment 2 specificity research

[0051] Take normal chicken embryo allantoic fluid, egg production drop syndrome virus, avian reovirus, avian infectious bursal disease virus, avian infectious bronchitis virus, Newcastle disease virus, and set up subgroup I avian adenovirus 12 The DNA templates of each serotype were amplified for specific detection by the LAMP method.

[0052] The 25μLLAMP reaction system is:

[0053] ReactionMix 12.5 μL, SEQIDNo.1 (10pmol) 1.0μL, SEQIDNo.2 (10pmol) 1.0μL, SEQIDNo.3 (10pmol) 2.0μL, SEQIDNo.4 (10pmol) 2.0μL, SEQIDNo.5 (10pmol) 1.0μL, SEQIDNo. .6 (10pmol) 1.0μL, EnzymeMix 1.0μL, sample to be tested 2.0μL, add DistilledWater to 25μL.

[0054] Reaction conditions: 60°C constant temperature for 60 minutes, 80°C for 2 minutes to terminate the reaction.

[0055] Observe the visualization results, and take 2 μLAMP reaction products for electrophoresis detection on 2% agarose gel.

[0056] The results showed that only the I subgroup avian ...

Embodiment 3

[0057] Embodiment 3 Sensitivity research

[0058] Extract I subgroup poultry adenovirus DNA, after measuring the concentration, carry out 10-fold serial dilution, the DNA concentration is 8.4ng / μL~8.4×10 -12 ng / μL, detected by established LAMP and conventional PCR at the same time, the sequence of conventional PCR primers is:

[0059] H3: AACGTCAACCCCTTCAAACCACC,

[0060] H4: TTGCCTGTGGCGAAAGGCGG,

[0061] Comparing the sensitivity of LAMP and conventional PCR detection.

[0062] The 25μLLAMP reaction system is:

[0063] ReactionMix 12.5 μL, SEQIDNo.1 (10pmol) 1.0μL, SEQIDNo.2 (10pmol) 1.0μL, SEQIDNo.3 (10pmol) 2.0μL, SEQIDNo.4 (10pmol) 2.0μL, SEQIDNo.5 (10pmol) 1.0μL, SEQIDNo. .6 (10pmol) 1.0μL, EnzymeMix 1.0μL, sample to be tested 2.0μL, add DistilledWater to 25μL.

[0064] Reaction conditions: constant temperature at 65°C for 60 minutes, and stop the reaction at 80°C for 2 minutes.

[0065] The 25μL PCR reaction system is:

[0066] 10×TaqBuffer 2.5μL, H3 (10pmol) 1.0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an LAMP primer pair used for I subgroup fowl adenovirus detection. The LAMP primer pair is composed of a pair of outer primers, a pair of inner primers and a pair of loop primers, wherein sequences of the outer primers are shown in SEQ ID NO.1 and SEQ ID NO.2; sequences of the inner primers are shown in SEQ ID NO.3 and SEQ ID NO.4; and sequences of the loop primers are shown in SEQ ID NO.5 and SEQ ID NO.6. Pathogens can be detected within about 60 minutes only by utilizing the LAMP primer pair provided by the invention, while the conventional PCR method needs 4-5 hours; meanwhile, an LAMP method has high sensitivity, minimum nucleic acid concentration is 8.4*10<-9> ng / muL, the sensitivity of the LAMP method is 10<4> times higher than that of the conventional PCR method, no expensive instrument is needed, detection result is easy to observe, and safety is good, so that the LAMP primer pair is applicable to being popularized to a primary veterinarian disease control and prevention organization or common farm.

Description

technical field [0001] The present invention relates to a detection method of avian adenovirus, in particular to a LAMP primer set and detection method based on LAMP technology for the detection of subgroup I adenovirus. Background technique [0002] Fowl adenovirus (fowladenovirus, FAV) belongs to the family Adenoviridae, which can spread both horizontally and vertically. It can also cause mild respiratory symptoms, decreased egg production, and pancreatic atrophy and necrosis. Subgroup I avian adenovirus is a linear double-stranded DNA virus with a common group antigen and a total of 12 serotypes (FAV1-FAV12). [0003] Rapid diagnosis and timely monitoring are important links in the prevention and control of adenovirus infection. Virus isolation and identification of biological characteristics can be used in the etiological diagnosis of adenovirus. The trial cycle is long and the operation is cumbersome, which cannot meet the needs of clinical disease prevention and contr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/6844C12Q1/701C12Q2531/119C12Q2565/125C12Q2563/107
Inventor 张贺楠张钊伟于雷周建民王增福田丁
Owner 乾元浩生物股份有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com