Tandem duck Alpha and Nu interferon genes and preparation method and application thereof
A gamma interferon and gene technology, applied in the field of tandem duck α and gamma interferon genes and their preparation, and gene fusion expression, can solve the problems that there are no two duck interferon genes in tandem expression and detect antiviral activity, etc., to achieve High antiviral activity, improved protection rate, and low cost effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] The construction of the prokaryotic expression plasmid of embodiment 1 tandem expression duck α, γ interferon gene
[0043] 1. Design and synthesis of primers
[0044] According to the duck IFN-α gene sequence (GenBankno.KJ874343) and IFN-γ gene sequence (GenBankno.KF746069) provided in Genbank, design 2 pairs of primers IFNα-F1, IFNα-R1 and IFNγ-F1, IFNγ-R1 , used to amplify the duck IFN-α and IFN-γ genes after removing the signal peptide, and add BamHI and HindIII restriction sites to the upstream and downstream of the two pairs of primers, respectively. At the same time, primers IFNα-R2 and IFNγ-F2 for SOE-PCR were designed, wherein IFNα-R2 contained part of the linker sequence, and IFNγ-F2 contained part of the linker sequence complementary to IFNα-R2. The primer sequences are as follows:
[0045] Amplification primers for IFN-α after signal peptide removal:
[0046] IFNα-F1: CGGGATCCTTCTCCTGCAGCCCCCTGCG;
[0047] IFNα-R1: CCCAAGCTTTTAGCGCATGGTGCGGGTGA;
[0048...
Embodiment 2
[0062] Identification and purification of the expression product of embodiment 2
[0063] The recombinant prokaryotic expression plasmid was transformed into BL21 competent bacteria, and after the positive colony was picked and expanded for culture, the expression of the protein was induced by IPTG, and the protein expression was identified by SDS-PAGE and western blot respectively. The detection results of western blot were as follows: figure 2 As shown, the detection results of SDS-PAGE are as follows image 3 shown. Collect the bacterial precipitates of each expression bacteria, add PBS to shake and mix, after ultrasonic cracking, separate the supernatant and precipitate, dissolve the precipitate with a phosphate solution containing 8mol / L urea, combine the solution with the Ni column packing for 1h, and pass Column, collect the filtrate, repeat the column twice, wash the column with a phosphate solution containing 30mmol / L imidazole, stop when the protein concentration o...
Embodiment 3
[0064] Example 3 Detection of expression product antiviral activity
[0065] In vitro antiviral activity detection: On DEF, according to the animal interferon in vitro antiviral activity detection method, the anti-VSV, AIV and DPV activities of the fusion protein rDuIFNα-linker-rDuIFNγ were detected respectively, with rDuIFN-α and rDuIFN-γ as the control group, The results showed that the anti-VSV, AIV and DPV activities of the fusion protein were 2.61×10 7 U / mg, 1.12×10 7 U / mg and 9.07×10 6 U / mg, significantly higher than the antiviral activity of a single duck interferon; in vivo antiviral activity detection: In Peking duck, the fusion protein rDuIFNα-linker-rDuIFNγ anti-AIV and DPV activities were detected, and rDuIFN-α and rDuIFN- γ is the control group. The experiment was carried out twice. Experiment 1: 1-day-old Peking ducks negative for avian influenza (H5N1) antibodies were screened out and randomly divided into 5 groups with 10 ducks in each group. , rDuIFN-γ pro...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com