Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Tandem duck Alpha and Nu interferon genes and preparation method and application thereof

A gamma interferon and gene technology, applied in the field of tandem duck α and gamma interferon genes and their preparation, and gene fusion expression, can solve the problems that there are no two duck interferon genes in tandem expression and detect antiviral activity, etc., to achieve High antiviral activity, improved protection rate, and low cost effects

Inactive Publication Date: 2016-06-08
SOUTH CHINA AGRI UNIV
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research on duck recombinant interferon is still limited to the expression and activity of a single interferon, and there is no example of expressing two duck interferon genes in tandem and testing their antiviral activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tandem duck Alpha and Nu interferon genes and preparation method and application thereof
  • Tandem duck Alpha and Nu interferon genes and preparation method and application thereof
  • Tandem duck Alpha and Nu interferon genes and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] The construction of the prokaryotic expression plasmid of embodiment 1 tandem expression duck α, γ interferon gene

[0043] 1. Design and synthesis of primers

[0044] According to the duck IFN-α gene sequence (GenBankno.KJ874343) and IFN-γ gene sequence (GenBankno.KF746069) provided in Genbank, design 2 pairs of primers IFNα-F1, IFNα-R1 and IFNγ-F1, IFNγ-R1 , used to amplify the duck IFN-α and IFN-γ genes after removing the signal peptide, and add BamHI and HindIII restriction sites to the upstream and downstream of the two pairs of primers, respectively. At the same time, primers IFNα-R2 and IFNγ-F2 for SOE-PCR were designed, wherein IFNα-R2 contained part of the linker sequence, and IFNγ-F2 contained part of the linker sequence complementary to IFNα-R2. The primer sequences are as follows:

[0045] Amplification primers for IFN-α after signal peptide removal:

[0046] IFNα-F1: CGGGATCCTTCTCCTGCAGCCCCCTGCG;

[0047] IFNα-R1: CCCAAGCTTTTAGCGCATGGTGCGGGTGA;

[0048...

Embodiment 2

[0062] Identification and purification of the expression product of embodiment 2

[0063] The recombinant prokaryotic expression plasmid was transformed into BL21 competent bacteria, and after the positive colony was picked and expanded for culture, the expression of the protein was induced by IPTG, and the protein expression was identified by SDS-PAGE and western blot respectively. The detection results of western blot were as follows: figure 2 As shown, the detection results of SDS-PAGE are as follows image 3 shown. Collect the bacterial precipitates of each expression bacteria, add PBS to shake and mix, after ultrasonic cracking, separate the supernatant and precipitate, dissolve the precipitate with a phosphate solution containing 8mol / L urea, combine the solution with the Ni column packing for 1h, and pass Column, collect the filtrate, repeat the column twice, wash the column with a phosphate solution containing 30mmol / L imidazole, stop when the protein concentration o...

Embodiment 3

[0064] Example 3 Detection of expression product antiviral activity

[0065] In vitro antiviral activity detection: On DEF, according to the animal interferon in vitro antiviral activity detection method, the anti-VSV, AIV and DPV activities of the fusion protein rDuIFNα-linker-rDuIFNγ were detected respectively, with rDuIFN-α and rDuIFN-γ as the control group, The results showed that the anti-VSV, AIV and DPV activities of the fusion protein were 2.61×10 7 U / mg, 1.12×10 7 U / mg and 9.07×10 6 U / mg, significantly higher than the antiviral activity of a single duck interferon; in vivo antiviral activity detection: In Peking duck, the fusion protein rDuIFNα-linker-rDuIFNγ anti-AIV and DPV activities were detected, and rDuIFN-α and rDuIFN- γ is the control group. The experiment was carried out twice. Experiment 1: 1-day-old Peking ducks negative for avian influenza (H5N1) antibodies were screened out and randomly divided into 5 groups with 10 ducks in each group. , rDuIFN-γ pro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses tandem duck Alpha and Nu interferon genes and a preparation method and application thereof and belongs to gene fusion expression in the biotechnical field. A nucleotide sequence of the tandem duck Alpha and Nu interferon genes is shown as in SEQ ID No. 1. The invention also provides the preparation method of the tandem duck Alpha and Nu interferon gene, a prokaryotic expression plasmid Alpha and Nu interferon prokaryotic expression plasmid pET32a-IFNAlpha-linker-IFNNuexpressing the tandem duck Alpha and Nu interferon gene and its preparation method, and application of a fusion protein expressed by the tandem duck Alpha and Nu interferon gene in the preparation of duck antiviral drugs. Recombinant duck Alpha and Nu interferon prokaryotic expression plasmid pET32a-IFNAlpha-linker-IFNNu is established successfully herein, the duck IFN-Alpha and IFN-Nu genes are tandemly expressed on an Escherichia coli prokaryotic expression system, and it is also possible to ensure that the two interferon genes are expressed in a ratio of 1:1.

Description

technical field [0001] The invention belongs to the gene fusion expression in the field of biotechnology, and in particular relates to a tandem duck alpha and gamma interferon gene and its preparation method and application. Background technique [0002] Interferon (interferon, IFN) is a kind of glycoprotein that has various biological functions such as anti-virus, anti-tumor and immune regulation on the same kind of cells. In 1957, it was first discovered by Isaacs et al. The International Interferon Nomenclature Committee divides interferon into two types according to the differences in the antigenic properties and molecular structure of interferon. Interferon-alpha (IFN-α) belongs to type I interferon. It was successfully cloned and expressed by Schultz et al. in 1995. Subsequently, researchers successively cloned the IFN-α genes of Peking duck, Muscovy duck, Shelduck duck and Shaoxing duck. The IFN-α gene consists of 576 nucleotides, encoding a total of 191 amino acids...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/62C12N15/10C12N15/70
CPCC07K14/56A61K38/00C07K14/57C07K2319/00C12N15/10C12N15/70C12N2800/101C12Q2525/191
Inventor 任涛高佩黎玉莲
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com