Strain capable of efficiently expressing alkaline pectinase and application of strain

A pectinase and alkaline technology, which is applied in the field of genetic engineering, can solve the problems that the yield of alkaline pectinase cannot be further improved, the industrial production of alkaline pectinase is restricted, and the high-efficiency expression of alkaline pectinase is restricted.

Inactive Publication Date: 2016-07-13
JIANGNAN UNIV
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the production of alkaline pectinase can be effectively increased by means of fermentation optimization, etc., when it reaches a certain limit, the production of alkaline pectinase cannot be further improved, which limits the industrial production of alkaline pectinase, so it is necessary to solve the limitation from the source Factors of Alkaline Pectinase Expression
[0004] Although th

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Strain capable of efficiently expressing alkaline pectinase and application of strain
  • Strain capable of efficiently expressing alkaline pectinase and application of strain
  • Strain capable of efficiently expressing alkaline pectinase and application of strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: Construction and identification of recombinant bacteria

[0032] Chemically synthesized sequence such as the alkaline pectinase gene PGL of SEQIDNO.1, and then design primers to obtain the optimized alkaline pectinase gene PGL by PCR, clone it into the expression vector pPIC9K, and obtain the recombinant plasmid pPIC9K- PGL (cloned expression plasmid map see attached figure 1 ), the recombinant vector was transformed into PichiapastorisGS115, and the recombinant strain PichiapastorisGS115-pPIC9K-PGL was obtained through screening and identification.

[0033] The primers are as follows (sequences are shown in SEQIDNO.2 and SEQIDNO.3 respectively):

[0034] PGL upstream: GCTGAAGCTTACGTAGAATTCGCTGATTTGGGTCATCAAACACTTG

[0035] Downstream of PGL: AAGGCGAATTAATTCGCGGCCGCTTAGTTCAATTTTCCAGCACCTGCT

[0036] The transformation of Pichia pastoris was performed by electroporation.

[0037] The specific steps are as follows: Pick a single colony of yeast recipient...

Embodiment 2

[0038] Embodiment 2: Alkaline pectinase activity assay and protein electrophoresis of genetic engineering strain

[0039] Cultivation method: After seed activation, the strain was inoculated into the basic fermentation medium YPD, cultured at 30°C and 220rpm for 14h, then transferred to the optimized growth medium BMGY and cultured at 30°C and 220rpm for 24h, and then the strain Transfer to the induction medium BMMY at 23°C, 220rpm, and add 1.5% methanol every 24h to induce the expression of alkaline pectinase.

[0040] Select Beyontian SDS-PAGE gel electrophoresis kit to prepare 12% separating gel and 5% stacking gel. For specific operation methods, please refer to the product manual. The sample was mixed with 5× loading buffer at a volume ratio of 4:1, boiled in water bath for 10 min, and loaded after cooling. During electrophoresis, the constant voltage is 80V. After the indicator enters the separation gel, the voltage is adjusted to 150V, and the electrophoresis is termin...

Embodiment 3

[0043] Embodiment 3: the purification of alkaline pectinase

[0044] Centrifuge the recombinant bacterial fermentation broth at 8000r / min for 20min, take the supernatant, add ammonium sulfate for gradient salting-out, collect 30-50% ammonium sulfate precipitated part by low-temperature centrifugation, and dissolve the salted-out precipitated enzyme in glycine-sodium hydroxide buffer Solution (pH7.5), dialyzed with 20mmol / L glycine-sodium hydroxide buffer solution for 24h. The supernatant obtained by centrifugation was further separated and purified by cation exchange chromatography.

[0045]

[0046]

[0047]

[0048]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a strain capable of efficiently expressing alkaline pectinase and an application of the strain and belongs to the technical field of gene engineering. Alkaline pectinase genes are expressed in Pichia pastoris GS115 with a gene recombination technology, and the strain GS115-PIC9K-PGL is obtained and has a remarkably improved yield by comparison with the yield before sequence optimization. According to the strain, the enzyme activity of the alkaline pectinase fermented for 72 h in a shaking flask is 301.9 U/ml and is improved by about 25%, and a good basis is laid for large-scale production of the alkaline pectinase. The alkaline pectinase produced with the strain can catalyze alpha-1,4 glycosidic bonds of polygalacturonic acid to be pyrolysed through trans-elimination under the alkaline condition and is widely applied to food, textile, papermaking and other industries.

Description

technical field [0001] The invention relates to a bacterial strain highly expressing alkaline pectinase and application thereof, belonging to the technical field of genetic engineering. Background technique [0002] Pectinase is a complex enzyme that breaks down pectin polymers into unsaturated oligogalacturonic acids. The enzyme is widely distributed and found in some parasitic nematodes, plants and microorganisms. Pectinase is widely used and has a history of industrial application for more than 40 years. Pectinases are divided into acid pectinases and alkaline pectinases PGL according to the optimum reaction pH. Among them, acid pectinase is mainly used in clarification of fruit juice and wine, extraction of fruit and vegetable juice, fruit peeling and so on. PGL applications are mainly used in textile, food, paper industry and environmental fields. The application of enzymatic method to the above-mentioned field-related reactions has the advantages of environmental p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/19C12N15/81C12N9/88A23L29/00D21C5/00D06M16/00C12R1/84
CPCC12N9/88C12N15/81C12N2800/102C12N2800/22C12Y402/02002D06M16/00D21C5/005
Inventor 刘松陈双全陈坚堵国成
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap