Strain capable of efficiently expressing alkaline pectinase and application of strain
A pectinase and alkaline technology, which is applied in the field of genetic engineering, can solve the problems that the yield of alkaline pectinase cannot be further improved, the industrial production of alkaline pectinase is restricted, and the high-efficiency expression of alkaline pectinase is restricted.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1: Construction and identification of recombinant bacteria
[0032] Chemically synthesized sequence such as the alkaline pectinase gene PGL of SEQIDNO.1, and then design primers to obtain the optimized alkaline pectinase gene PGL by PCR, clone it into the expression vector pPIC9K, and obtain the recombinant plasmid pPIC9K- PGL (cloned expression plasmid map see attached figure 1 ), the recombinant vector was transformed into PichiapastorisGS115, and the recombinant strain PichiapastorisGS115-pPIC9K-PGL was obtained through screening and identification.
[0033] The primers are as follows (sequences are shown in SEQIDNO.2 and SEQIDNO.3 respectively):
[0034] PGL upstream: GCTGAAGCTTACGTAGAATTCGCTGATTTGGGTCATCAAACACTTG
[0035] Downstream of PGL: AAGGCGAATTAATTCGCGGCCGCTTAGTTCAATTTTCCAGCACCTGCT
[0036] The transformation of Pichia pastoris was performed by electroporation.
[0037] The specific steps are as follows: Pick a single colony of yeast recipient...
Embodiment 2
[0038] Embodiment 2: Alkaline pectinase activity assay and protein electrophoresis of genetic engineering strain
[0039] Cultivation method: After seed activation, the strain was inoculated into the basic fermentation medium YPD, cultured at 30°C and 220rpm for 14h, then transferred to the optimized growth medium BMGY and cultured at 30°C and 220rpm for 24h, and then the strain Transfer to the induction medium BMMY at 23°C, 220rpm, and add 1.5% methanol every 24h to induce the expression of alkaline pectinase.
[0040] Select Beyontian SDS-PAGE gel electrophoresis kit to prepare 12% separating gel and 5% stacking gel. For specific operation methods, please refer to the product manual. The sample was mixed with 5× loading buffer at a volume ratio of 4:1, boiled in water bath for 10 min, and loaded after cooling. During electrophoresis, the constant voltage is 80V. After the indicator enters the separation gel, the voltage is adjusted to 150V, and the electrophoresis is termin...
Embodiment 3
[0043] Embodiment 3: the purification of alkaline pectinase
[0044] Centrifuge the recombinant bacterial fermentation broth at 8000r / min for 20min, take the supernatant, add ammonium sulfate for gradient salting-out, collect 30-50% ammonium sulfate precipitated part by low-temperature centrifugation, and dissolve the salted-out precipitated enzyme in glycine-sodium hydroxide buffer Solution (pH7.5), dialyzed with 20mmol / L glycine-sodium hydroxide buffer solution for 24h. The supernatant obtained by centrifugation was further separated and purified by cation exchange chromatography.
[0045]
[0046]
[0047]
[0048]
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 