A method for rapid gene knockout of Bacillus licheniformis
A Bacillus licheniformis, gene knockout technology, applied in biochemical equipment and methods, glycosylase, virus/bacteriophage, etc., can solve the problems of complex carrier structure, complex construction process, low transformation efficiency, etc., and achieve the construction process Simple, efficient integration process, and the effect of improving work efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0076] Gene knockout fragment construction
[0077] (i) extracting the DNA of the Bacillus licheniformis thallus, using the DNA as a template, performing PCR amplification to obtain the homology arm GH1;
[0078] Described PCR primer sequence is as follows:
[0079] f 1 :CG GGATCC AACCGTTTCTTTTATCCGCAGT
[0080] R 1 :CCAGCAAAATTCAGCATCTCTCGGTTAAGCA
[0081] Wherein, the underline is marked as the BamH I restriction site;
[0082] The PCR amplification system is 50 μl:
[0083] 2×HiFi-PCR master 25μl, 10μmol / L primer F1 2.0μl, 10μmol / L primer R1 2.0μl, template 2.0μl, use ddH 2 O make up 50 μl;
[0084] The PCR amplification procedure is as follows:
[0085] Pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 57°C for 30 sec, extension at 72°C for 1.5 min, 30 cycles; extension at 72°C for 10 min, storage at 4°C;
[0086] Agarose gel electrophoresis check PCR product, length is 549bp (SEQ ID NO.3, such as figure 2 shown), use the SanPrep...
Embodiment 2
[0109] Preparation of Bacillus licheniformis competent
[0110] (i) Pick a single colony of Bacillus licheniformis on the surface of fresh LB solid medium, inoculate it in 10 mL of GM (expansion) medium, cultivate overnight at 37°C and 220r / min;
[0111] (ii) Take 1mL of the above bacterial solution and transfer it to 100mL GM (expansion) liquid medium, and cultivate to OD at 37°C and 220r / min 600 =0.9;
[0112] (iii) Transfer the bacterial solution to a 100mL centrifuge tube and place in an ice bath for 20 minutes to stop the growth of the bacterial cells;
[0113] (iv) Centrifuge at 4°C, 5000g, 5min after ice bath, and collect the bacteria;
[0114] (v) The thalline after centrifugation is washed 3 times with pre-cooled electroporation buffer (ETM);
[0115] (vi) After washing, use 1000uL electroporation buffer to resuspend the bacteria;
[0116] (vii) Aliquot the prepared competent cells into 100 μL tubes and store at -80°C for later use.
[0117] Among them, GM: LB+0....
Embodiment 3
[0120] GH1-Cm r Fragment transformation of Bacillus licheniformis cells
[0121] (i) the GH1-Cm that embodiment 1 makes r Fragments were digested with restriction endonuclease BamH I;
[0122] Enzyme digestion system (40uL) is as follows:
[0123]
[0124] (ii) Concentrate and purify the digested product
[0125] (1) Add 1 / 10 volume of 3M sodium acetate and 2.5 volumes of absolute ethanol, and place in a -20°C refrigerator for 20 minutes;
[0126] (2) Centrifuge at 12000r / min for 5min to obtain a precipitate;
[0127] (3) 300 μL of 75% ethanol by volume to resuspend the pellet;
[0128] (4) Centrifuge at 12000r / min for 5min, remove ethanol, and air-dry at 37°C for 30min;
[0129] (5) Add 15-18μL ddH 2 O Resuspend DNA and store at -20°C.
[0130] (iii) Electroconversion
[0131] Determination of GH1-Cm by Nucleic Acid Ultramicro Spectrophotometer r Fragment concentration, after reaching a concentration of 2000μg / ml, perform electroporation, the electroporation cond...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



