A method for rapid gene knockout of Bacillus licheniformis

A Bacillus licheniformis, gene knockout technology, applied in biochemical equipment and methods, glycosylase, virus/bacteriophage, etc., can solve the problems of complex carrier structure, complex construction process, low transformation efficiency, etc., and achieve the construction process Simple, efficient integration process, and the effect of improving work efficiency

Active Publication Date: 2019-11-05
QILU UNIV OF TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the method of gene knockout based on the above principles has been widely used, the overall construction process is complicated and the operation cycle is long
[0004] For example, the serpin gene knockout vector constructed in Chinese patent document CN103146739A (application number: CN201310070885) is composed of upstream homology arm (Up-serpin), resistance gene, downstream homology arm (Down-serpin) and pUC57 and other elements connected end-to-end. Therefore, only the construction of the vector requires several enzyme digestion ligation and sequencing operations, and it takes several weeks or even more than a month to complete the entire operation cycle. At the same time, due to the complex structure of the vector and the long sequence, the transformation efficiency is generally low.
Although the above method can achieve special needs such as gene knockout without trace, but in the gene knockout operation for the purpose of gene function verification, this kind of method often becomes the speed-limiting link of the whole experimental process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for rapid gene knockout of Bacillus licheniformis
  • A method for rapid gene knockout of Bacillus licheniformis
  • A method for rapid gene knockout of Bacillus licheniformis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Gene knockout fragment construction

[0077] (i) extracting the DNA of the Bacillus licheniformis thallus, using the DNA as a template, performing PCR amplification to obtain the homology arm GH1;

[0078] Described PCR primer sequence is as follows:

[0079] f 1 :CG GGATCC AACCGTTTCTTTTATCCGCAGT

[0080] R 1 :CCAGCAAAATTCAGCATCTCTCGGTTAAGCA

[0081] Wherein, the underline is marked as the BamH I restriction site;

[0082] The PCR amplification system is 50 μl:

[0083] 2×HiFi-PCR master 25μl, 10μmol / L primer F1 2.0μl, 10μmol / L primer R1 2.0μl, template 2.0μl, use ddH 2 O make up 50 μl;

[0084] The PCR amplification procedure is as follows:

[0085] Pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 57°C for 30 sec, extension at 72°C for 1.5 min, 30 cycles; extension at 72°C for 10 min, storage at 4°C;

[0086] Agarose gel electrophoresis check PCR product, length is 549bp (SEQ ID NO.3, such as figure 2 shown), use the SanPrep...

Embodiment 2

[0109] Preparation of Bacillus licheniformis competent

[0110] (i) Pick a single colony of Bacillus licheniformis on the surface of fresh LB solid medium, inoculate it in 10 mL of GM (expansion) medium, cultivate overnight at 37°C and 220r / min;

[0111] (ii) Take 1mL of the above bacterial solution and transfer it to 100mL GM (expansion) liquid medium, and cultivate to OD at 37°C and 220r / min 600 =0.9;

[0112] (iii) Transfer the bacterial solution to a 100mL centrifuge tube and place in an ice bath for 20 minutes to stop the growth of the bacterial cells;

[0113] (iv) Centrifuge at 4°C, 5000g, 5min after ice bath, and collect the bacteria;

[0114] (v) The thalline after centrifugation is washed 3 times with pre-cooled electroporation buffer (ETM);

[0115] (vi) After washing, use 1000uL electroporation buffer to resuspend the bacteria;

[0116] (vii) Aliquot the prepared competent cells into 100 μL tubes and store at -80°C for later use.

[0117] Among them, GM: LB+0....

Embodiment 3

[0120] GH1-Cm r Fragment transformation of Bacillus licheniformis cells

[0121] (i) the GH1-Cm that embodiment 1 makes r Fragments were digested with restriction endonuclease BamH I;

[0122] Enzyme digestion system (40uL) is as follows:

[0123]

[0124] (ii) Concentrate and purify the digested product

[0125] (1) Add 1 / 10 volume of 3M sodium acetate and 2.5 volumes of absolute ethanol, and place in a -20°C refrigerator for 20 minutes;

[0126] (2) Centrifuge at 12000r / min for 5min to obtain a precipitate;

[0127] (3) 300 μL of 75% ethanol by volume to resuspend the pellet;

[0128] (4) Centrifuge at 12000r / min for 5min, remove ethanol, and air-dry at 37°C for 30min;

[0129] (5) Add 15-18μL ddH 2 O Resuspend DNA and store at -20°C.

[0130] (iii) Electroconversion

[0131] Determination of GH1-Cm by Nucleic Acid Ultramicro Spectrophotometer r Fragment concentration, after reaching a concentration of 2000μg / ml, perform electroporation, the electroporation cond...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for achieving bacillus licheniformis gene knockout rapidly. The method comprises the following steps of 1, obtaining a gene fragment in a bacillus licheniformis to-be-knocked-out gene coding frame as a homologous arm sequence; 2, obtaining a resistance label gene fragment; 3, conducting an overlapped and extended PCR on the homologous arm sequence and the resistance label gene fragment, so that a fused gene sequence of the homologous arm sequence and the resistance label gene fragment is obtained, and treating the fused gene sequence as a gene knockout fragment for use; 4, conducting single digestion on the fused gene sequence, converting bacillus licheniformis competent cells, and conducting recovery culture and screening culture, so that bacillus licheniformis with a gene knocked out is obtained. According to the method, the bacillus licheniformis gene is knocked out based on the single exchange principle, in the knockout process, homologous recombination only needs to be generated once, and the integration process is high in efficiency; whole knockout and screening work can be completed within three or four days, the gene knockout cycle is short, and knockout cost is effectively lowered.

Description

technical field [0001] The invention relates to a method for quickly realizing gene knockout of Bacillus licheniformis, belonging to the technical field of biotechnology. Background technique [0002] Bacillus licheniformis (Bacillus licheniformis), a Gram-positive thermophilic bacterium that exists widely in nature and can resist harsh environments, is one of the important production strains in the field of biotechnology industry. At present, it is mainly used in medicine, biological washing powder, nanotechnology and other fields, and has emerged in the degradation of biomass materials. It has been reported to regulate the metabolism of Bacillus licheniformis by molecular modification to achieve the accumulation of target products. [0003] Gene knockout (gene knockout), also known as gene targeting, is a new type of molecular biology technology. It uses DNA transformation technology to introduce the constructed targeting vector into the target cell, and then recombines t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/75
CPCC12N9/2402C12N15/75C12N2800/101C12Y302/01
Inventor王瑞明汪俊卿韩海红韩登兰王腾飞肖静
OwnerQILU UNIV OF TECH