Check patentability & draft patents in minutes with Patsnap Eureka AI!

RNAi (RNA interfere) plant expression vector and application thereof

A plant expression vector and plant technology, applied in the field of RNAi plant expression vector and its construction, can solve the problems of death, inability to degrade bentazon in vivo, plant death, etc., and achieve the effect of preventing transgene escape

Active Publication Date: 2016-07-27
HAINAN BOLIAN RICE GENE TECH CO LTD
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The mutation of the CYP81A6 gene causes the above mutants to be unable to degrade bendazone in vivo, resulting in plant death when spraying bendazone herbicide
At the same time, the cytochrome P450 is also the target of sulfonylurea herbicides. Plants containing CYP81A6 mutant gene or bendazone-sensitive plants will also cause death when spraying sulfonylurea herbicides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RNAi (RNA interfere) plant expression vector and application thereof
  • RNAi (RNA interfere) plant expression vector and application thereof
  • RNAi (RNA interfere) plant expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] The acquisition of embodiment 1 bacterial strain, plasmid and the synthesis of PCR primer

[0049] (1) Strains and plasmids

[0050] The plant binary transformation vector pTCK303 as backbone vector contains hygromycin resistance gene, maize Ubi promoter and NOS terminator; pMD18-T cloning vector (Takara). The strain of Escherichia coli (Escherichiacoli) is DH5α; the strain of Agrobacterium tumefacieus is EHA105.

[0051] (2) PCR primer sequence

[0052] The enzyme cutting sites of the forward primer were designed as KpnⅠ and ClaⅠ, and the restriction enzyme cutting sites of the reverse primer were XholⅠ and BamHI.

[0053] P450RNAi-F2GGGGTACCATCGATGAAGCGGAGGCTGTTCG

[0054] P450RNAi-R2CCGCTCGAGGGATCCCTTGCGCTTTCTTGAGTGTG

Embodiment 2

[0055] Construction and transformation of embodiment 2RNAi plant expression vector

[0056] In order to construct the interference vector of cytochrome P450 gene CYP81A6, rice cDNA was used as a template, and the P450i-2 gene fragment was amplified by PCR using the primers in Example 1. The amplification system and procedures are as follows:

[0057] Program: Pre-denaturation at 94°C for 5-10min, denaturation at 94°C for 30s, annealing at 57°C for 30s, extension at 72°C for 30s, 30-35 cycles, extension at 72°C for 30s; end at 16°C.

[0058]

[0059] A 494bp gene fragment matching the expected size was amplified. After recovery, it was connected to the pMD18-T vector (Takara) and named pMD18-T-P450i-2. The sequence of the fragment was verified to be correct by sequencing. The plant binary transformation vector used is pTCK303 (such as figure 1 Shown in A), cut the pTCK303 vector and pMD18-T-P450i-2 respectively according to the enzyme cutting site, and connect the target f...

Embodiment 3

[0060] Embodiment 3 Agrobacterium transformed rice and identification of transgenic plants

[0061] The pTCK303-P450i-2 recombinant plasmid was introduced into the Agrobacterium EHA105 strain, and the callus of japonica rice Zhonghua 11 was transformed. After hygromycin resistance selection, differentiation, and rooting, 45 regenerated transgenic lines were obtained, and the transgenic plants were identified by PCR. The hygromycin resistance gene was introduced, and the results showed that 36 PCR positive plants ( image 3 ), the positive plants were transplanted into the soil, and 30 survived.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an RNAi (Ribonucleic Acid interfere) plant expression vector, a construction method thereof, a method for interfering the expression of a plant cytochrome P450 gene CYP81A6 and a method for obtaining herbicide dominance sensitive plants. The RNAi plant expression vector is used for converting rice, the expression of the gene CYP81A6 can be successfully inhibited, a situation that the rice has resistance to the herbicide is changed into the situation that the rice is sensitive to the herbicide, and therefore, the rice which is sensitive to dominance of the herbicide is cultured. Therefore, sensitive plants can be removed in a way of applying the herbicide. The rice has important application value on the aspects that a new transgenosis variety is cultured, seeds are produced by hybrid rice, transgene escape is avoided and the like.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and specifically relates to an RNAi plant expression vector capable of inhibiting the expression of cytochrome P450 gene, its construction method and application. Background technique [0002] The utilization of crop heterosis is one of the important means to increase agricultural production. Rice is one of the most important food crops in the world, with obvious heterosis. China is the first country in the world to successfully realize the commercial production of hybrid rice. Hybrid rice has increased my country's rice production by 20%. The annual planting area of ​​hybrid rice in the country has exceeded 50% of the annual planting area of ​​rice. The "three-line method" and "two-line method" are currently the main methods for hybrid rice seed production, but due to the genotype limitation of the three-line nucleoplasmic interaction and the instability of the light and temperature se...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H5/00
CPCC12N15/8205C12N15/8216C12N15/8278
Inventor 黄培劲安保光欧阳超陈思兰吴永忠
Owner HAINAN BOLIAN RICE GENE TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More