Transgenic agrobacterium strain for expressing recombined human albumin genes in plants

A human albumin, transgenic technology, applied in the direction of serum albumin, plant gene improvement, animal/human protein, etc., can solve the problem that human albumin is not suitable for industrial production.

Inactive Publication Date: 2016-08-17
王大勇
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to solve the problem that the current human albumin is not suitable for industrial production with microorganisms and animals as reactors, and to provide two recombinant human albumin gene sequences and their transgenic engineering strains

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenic agrobacterium strain for expressing recombined human albumin genes in plants
  • Transgenic agrobacterium strain for expressing recombined human albumin genes in plants
  • Transgenic agrobacterium strain for expressing recombined human albumin genes in plants

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0025] Specific embodiment 1: The "basic sequence" of the recombinant human albumin transgene in this embodiment is as follows:

[0026]GCCACCATGGATGCACACAAGAGTGAGGTTGCTCATCGGTTTAAAGATTTGGGAGAAGAAAATTTCAAAGCTTTGGTGTTGATTGCCTTTGCTCAGTATCTTCAGCAGTGTCCATTTGAAGATCATGTAAAATTAGTGAATGAAGTAACTGAATTTGCAAAAACATGTGTTGCTGATGAGTCAGCTGAAAATTGTGACAAATCACTTCATACCCTTTTTGGAGACAAATTATGCACAGTTGCAACTCTTCGTGAAACCTATGGTGAAATGGCTGACTGCTGTGCAAAACAAGAACCTGAGAGAAATGAATGCTTCTTGCAACACAAAGATGACAACCCAAACCTCCCCCGATTGGTGAGACCAGAGGTTGATGTGATGTGCACTGCTTTTCATGACAATGAAGAGACATTTTTGAAAAAATACTTATATGAAATTGCCAGAAGACATCCTTACTTTTATGCCCCGGAACTCCTTTTCTTTGCTAAAAGGTATAAAGCTGCTTTTACAGAATGTTGCCAAGCTGCTGATAAAGCTGCCTGCCTGTTGCCAAAGCTCGATGAACTTCGGGATGAAGGGAAGGCTTCGTCTGCCAAACAGAGACTCAAGTGTGCCAGTCTCCAAAAATTTGGAGAAAGAGCTTTCAAAGCATGGGCAGTAGCTCGCCTGAGCCAGAGATTTCCCAAAGCTGAGTTTGCAGAAGTTTCCAAGTTAGTGACAGATCTTACCAAAGTCCACACGGAATGCTGCCATGGAGATCTGCTTGAATGTGCTGATGACAGGGCGGACCTTGCCAAGTATATCTGTGAAAATCAAGATTCGATCTCCAGTAAACTGAAGGAATGCTGTGAAAAACCTCTG...

specific Embodiment approach 2

[0030] Specific embodiment two: The "improved sequence" of the recombinant human albumin transgene in this embodiment is as follows:

[0031] GCCACCATGCATCATCACCATCACCATGATGACGACGATAAGGATGCACACAAGAGTGAGGTTGCTCATCGGTTTAAAGATTTGGGAGAAGAAAATTTCAAAGCTTTGGTGTTGATTGCCTTTGCTCAGTATCTTCAGCAGTGTCCATTTGAAGATCATGTAAAATTAGTGAATGAAGTAACTGAATTTGCAAAAACATGTGTTGCTGATGAGTCAGCTGAAAATTGTGACAAATCACTTCATACCCTTTTTGGAGACAAATTATGCACAGTTGCAACTCTTCGTGAAACCTATGGTGAAATGGCTGACTGCTGTGCAAAACAAGAACCTGAGAGAAATGAATGCTTCTTGCAACACAAAGATGACAACCCAAACCTCCCCCGATTGGTGAGACCAGAGGTTGATGTGATGTGCACTGCTTTTCATGACAATGAAGAGACATTTTTGAAAAAATACTTATATGAAATTGCCAGAAGACATCCTTACTTTTATGCCCCGGAACTCCTTTTCTTTGCTAAAAGGTATAAAGCTGCTTTTACAGAATGTTGCCAAGCTGCTGATAAAGCTGCCTGCCTGTTGCCAAAGCTCGATGAACTTCGGGATGAAGGGAAGGCTTCGTCTGCCAAACAGAGACTCAAGTGTGCCAGTCTCCAAAAATTTGGAGAAAGAGCTTTCAAAGCATGGGCAGTAGCTCGCCTGAGCCAGAGATTTCCCAAAGCTGAGTTTGCAGAAGTTTCCAAGTTAGTGACAGATCTTACCAAAGTCCACACGGAATGCTGCCATGGAGATCTGCTTGAATGTGCTGATGACAGGGCGGACCTTGCCAAGTATATCTGTGAAAATCAAGATTCG...

specific Embodiment approach 3

[0033] Embodiment 3: The recombinant human albumin transgenic engineering strain in this embodiment is Agrobacterium containing human albumin gene plasmid, wherein the human albumin gene sequence in the plasmid is "basic sequence" or "improved sequence".

[0034]In this embodiment, the recombinant human albumin transgenic engineered bacteria are Gram-negative bacteria, Brevibacterium non-spores, with a bacterial width of 0.6-1.0 μm and a bacterial length of 1.5-3.0 μm. The temperature is 28°C, and the optimum pH is pH 6.0; the colonies are usually round, raised, smooth, white to off-white, translucent, and resistant to rifampicin and kanamycin.

[0035] In this embodiment, the human albumin gene sequence is cloned into the pGEM-T vector, the gene sequence is amplified by PCR to obtain the "basic sequence" and "improved sequence", and Xba and Xma Double enzyme digestion, recover the digested product, and use T4 DNA ligase or In-Fusion kit to clone the recombinant human serum...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an agrobacterium strain for expressing recombined human albumin genes in plants, solving the problem that microorganisms and animals are not suitable for being used as reactors for industrial production of recombined human albumin currently. The recombined human albumin transgenic engineering strain is agrobacterium with recombined human albumin gene plasmids, and expressed protein is human albumin. According to the recombined human albumin gene sequence in the strain, a human albumin open-reading-frame basic-group 'basic sequence' of a Kozak sequence is inserted in front of a start codon, or a sequence (6xHis) of six repeated histidines is inserted in back of an N-end start codon on that basis, and an 'improved sequence' formed by sequence connection of code enterokinase substrates is arranged between the 6xHis and the albumin sequence. The recombined human albumin transgenic engineering strain can be applied to mass production of genetically recombined human albumin by transgenic plants.

Description

[0001] technology neighborhood [0002] The invention relates to an agrobacterium strain for expressing recombinant human serum albumin gene in plants, which is used for expressing and preparing recombinant human serum albumin by using plants. Transformation plasmids in Agrobacterium contain the basic sequence of albumin or a modified sequence with a histone tag and an enterokinase substrate sequence linked at the N-terminus. Background technique [0003] Human serum albumin (human serum albumin, HSA) is a single-chain non-glycosylated protein composed of 585 amino acids, with a molecular mass of 66.5kD and an isoelectric point between 4.7-4.9. It is the main protein in human blood, accounting for about 60% of the total plasma protein, and contains about 40g of human albumin per liter of human blood. In addition to plasma, human albumin is also present in tissues, body fluids, skin and lymphatic cavities. HSA precursor (preproHSA) is synthesized in the liver, and processed a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/21C12N15/14C12N15/62C12N15/84C12R1/01
CPCC07K14/765C07K2319/21C12N15/8205C12N15/8257
Inventor 王大勇陈林涛韦双双
Owner 王大勇
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products