Small interfering ribonucleic acid (siRNA) capable of interfering alpaca melanin cell CDK5 gene expression, expression plasmid and application thereof

A technology for melanocytes and expression plasmids, which is applied in the field of siRNA fragments and shRNA expression plasmids, and can solve the problems of lack of optimal and interfering siRNA

Active Publication Date: 2016-08-17
SHANXI AGRI UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to solve the problem in the prior art that there is no optimal siRNA that interferes with the expression of alpaca melanocyte CDK5 gene, and provides an siRNA that interferes with the expression of alpaca melanocyte CDK5 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Small interfering ribonucleic acid (siRNA) capable of interfering alpaca melanin cell CDK5 gene expression, expression plasmid and application thereof
  • Small interfering ribonucleic acid (siRNA) capable of interfering alpaca melanin cell CDK5 gene expression, expression plasmid and application thereof
  • Small interfering ribonucleic acid (siRNA) capable of interfering alpaca melanin cell CDK5 gene expression, expression plasmid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Design artificial siRNA sequences that interfere with alpaca CDK5 gene expression, and screen CDK5 siRNAs by cell transfection.

[0033] According to the full-length CDK5 sequence (HM623674) amplified from alpaca skin, and referring to the siRNA design principles, three siRNA double-stranded artificial sequences shown in Table 1 below were designed and screened.

[0034]

[0035] Inoculate 2 × 10 per well in a six-well tissue culture plate 5 Melanocytes, 2ml normal culture without antibiotics and fetal bovine serum, cultured in a carbon dioxide incubator for 18-24 hours, until the cells adhered to 60-80%. Prepare the liquid as follows: Solution A: Dilute 2-8µl siRNA duplex with 100µl siRNA transfection medium sc-36868 for each transfection; Solution B: Dilute 2-8µl siRNA transfection reagent sc-29528 with 100µl for each transfection siRNA transfection medium sc-36868 diluted.

[0036] Add the siRNA duplex (solution A) directly into the diluted transfection reagent ...

Embodiment 2

[0043] According to the CDK5 siRNA sequence screened in Example 1, the shRNA with the sense strand and antisense strand sequence shown in Seq ID No.3 and Seq ID No.4 is designed, and the shRNA is identified as Seq ID No.1 and Seq ID No. The 2 sequence is used as the stem structure of shRNA, and CGAA and UUCG are used as the hairpin structure between the two, thus forming the shRNA structure:

[0044] Sense Strand: 5’-CACC GCGACAAGAAGCUGACUUU CGAA AAAGUCAGCUUCUUGUCGC -3'

[0045] Antisense strand: 5'-AAAA GCGACAAGAAGCUGACUUUUUCG AAAGUCAGCUUCUUGUCGC -3'.

[0046] According to the above shRNA sequence, a pair of shRNA oligomeric single-stranded DNA was synthesized, and a negative control sequence was attached. The specific sequence is shown in Table 2.

[0047]

[0048] Annealing of double-stranded DNA: use ddH to synthesize 1 pair of oligomeric single-stranded DNA 2 O was dissolved to 100 µM, 5 µl of each complementary single strand was mixed, and annealed according t...

Embodiment 3

[0064] The alpaca CDK5 pENTR / U6 shRNA expression plasmid was used to transfect melanocytes through liposomes, and the biological effects of melanocytes were analyzed.

[0065] During transfection, take recovered 1×10 5 Melanocytes were seeded in six-well plates and cultured in melanocyte medium (Sciencell, San Diego, USA) for 24 hours, and adhered to 70%. On the second day, the medium was discarded, and 800 µL of serum-free medium was added, and the complex of DNA fectin Transfection Reagent (TIANGEN BIOTECH, BEIJING CO. LTD) and alpaca CDK5 pENTR / U6 shRNA was added and mixed, and incubated at 37°C for 20 Hour. Remove the transfection reagent, add 20ml complete medium containing serum, and culture at 37°C for 3 days. Cells were collected for RNA extraction. Each experimental group has 3 repetitions.

[0066] Real-time fluorescent quantitative PCR experiments were performed to detect changes in the expression of target genes.

[0067] The primers required are as follows: ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses small interfering ribonucleic acid (siRNA) capable of interfering alpaca melanin cell CDK5 gene expression. The siRNA has positive-sense strand and antisense strand sequences as shown in Seq ID No. 1 and Seq ID No. 2; a pENTR / U6 short hairpin RNA (shRNA) expression plasmid capable of interfering the alpaca melanin cell CDK5 gene expression is also established. The biological effect of the pENTR / U6 (shRNA) expression plasmid shows a regulating function for alpaca melanin cell lines TYR and MC1R in a melanin cell line as well as an influence on phenotypic change of hair color of a mouse.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and relates to an siRNA fragment for interfering with alpaca melanocyte CDK5 gene expression and an shRNA expression plasmid thereof. Background technique [0002] Cyclin-dependent Kinase 5 (CDK5) is a member of the cyclin-dependent kinase (CDK) family. CDK5 was first isolated from bovine brain tissue by biochemical methods and was discovered in 1992. be found. CDK5 is a proline-guided serine / threonine kinase that regulates the phosphorylation / dephosphorylation of the cell division cycle of eukaryotic cells. [0003] Studies have shown that CDK5 is mainly expressed in neurons and is closely related to the development of the nervous system and the normal function of neurons. Recently, CDK5 was found to be expressed in non-neuronal tissues or cells, such as in the epithelial cells of mouse lens and rabbit cornea, which can regulate the adhesion and migration of cells to matrix and cells. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/11C12N15/85C12N5/10A01K67/027
CPCA01K67/027A01K2227/105A01K2267/02C12N15/1137
Inventor范瑞文董常生张俊珍杨珊珊姬凯元石占全刘彧胡帅鹏刘学贤
OwnerSHANXI AGRI UNIV