Biological method for improving yield of L-5-methyltetrahydrofolate by virtue of two-plasmid engineering bacteria

A technology of methyltetrahydrofolate and recombinant plasmid is applied in the field of synthesis of metabolic engineering technology, and can solve the problems of high production cost, difficult separation of optical isomers, complicated synthesis process by chemical synthesis method, etc., and achieves reduction of production cost. and energy consumption, the effect of improving the utilization rate of raw materials

Inactive Publication Date: 2016-08-17
CHINA PHARM UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The synthesis process of the chemical synthesis method is complicated, the separation of optical isomers is difficult, and the production cost is also high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biological method for improving yield of L-5-methyltetrahydrofolate by virtue of two-plasmid engineering bacteria
  • Biological method for improving yield of L-5-methyltetrahydrofolate by virtue of two-plasmid engineering bacteria
  • Biological method for improving yield of L-5-methyltetrahydrofolate by virtue of two-plasmid engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Construction of embodiment 1 co-expression plasmid

[0040] 1.1 Primer design

[0041] According to the GlyA and MetF sequences reported by NCBI, the following 4 primers were designed:

[0042]GlyAUP: AAGCTTATGTTAAAGCGTGAAATGAACA

[0043] GlyADOWN: GAATTCTTATGCTGAAACCGGGTAAC

[0044] MetFUP: GAGCTCATGAGCTTTTTTCACGCCAG

[0045] MetFDOWN: CTCGAGTTATAAACCAGGTCGAACCCC

[0046] Among them, GlyAUP and GlyADOWN are used to amplify the GlyA coding region; MetFUP and MetFDOWN are used to amplify the MetFDE coding region; GlyAUP, GlyADOWN, MetFUP, and MetFDOWN are respectively introduced with HindIII restriction sites, EcoRI restriction sites, and SacI restriction sites , XhoI restriction site.

[0047] 1.2 PCR amplification of GlyA sequence

[0048] The genome of Escherichia coli E.coli BL21 was extracted.

[0049] Using the Escherichia coli E.coli BL21 genome as a template, and using GlyAUP and GlyADOWN designed in step 1.1 as primer pairs, perform PCR amplification, as ...

Embodiment 2

[0070] Transform the plasmids pET28a-GlyA-MetF, pET28a-GlyA and pET28a(+) into the host strain E.coliBL21(DE3), respectively named PGM01, PGM02 and P03, and coat solid LB containing 50 μg / mL kanamycin Plates were cultured at 37°C until the transformants grew out. Among them, E.coli BL21(DE3) is a non-kanamycin-resistant strain and cannot grow on a solid LB plate containing kanamycin. Therefore, the transformants grown on the plate are transformed with pET28a-GlyA-MetF , pET28a-GlyA and pET28a(+) plasmids in E. coli.

[0071] Randomly pick a number of transformants containing pET28a-GlyA-MetF, pET28a-GlyA and pET28a(+) plasmids, shake flask fermentation culture, add inducer when the OD value is between 0.6 and 0.8, and induce for 4 to 10 hours , sonicate the cells, and perform SDS-PAGE on the soluble protein, the results are as follows Figure 5 . according to Figure 5 The results showed that PGM01 and PGM02 expressed high levels of GlyA, MetF and GlyA, respectively, in li...

Embodiment 3

[0074] Embodiment 3PGM01 and PGM02 and E.coli BL21 (DE3) shake flask fermentation L-5-methyltetrahydrofolate

[0075] Single colonies of PGM01, PGM02 and E.coli BL21(DE3) (original bacteria, named BL21) grown overnight on solid LB plates at 37°C were inserted into liquid LB medium, and cultured in shake flasks overnight.

[0076] Take an appropriate amount of bacterial solution and transfer it into the shake flask fermentation medium, and cultivate for 11 hours. Then 1% was inoculated, and the inducer was added when the OD value was between 0.6 and 0.8; the precursor folic acid 0.05g and glycerol 8% were added in due course, and samples were taken at 4h, 6h, 8h, and 10h of fermentation to detect the L- The cumulative amount of 5-methyltetrahydrofolate, the test results are as follows figure 1 shown.

[0077] According to the results in Table 1, the accumulation of L-5-methyltetrahydrofolate in PGM01, PGM02 and BL21 reached the highest level at 10 hours of fermentation, reach...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a biological synthesis method for increasing the accumulation of L-5-methyltetrahydrofolate, an L-5-methyltetrahydrofolate synthetase system co-expressed recombinant plasmid and a construction method and application thereof. The L-5-methyltetrahydrofolate synthetase system co-expressed recombinant plasmid comprises serine hydroxymethyltransferase (SHMT) gene GlyA and methylenetetrahydrofolate reductase (MTHFR) gene MetF sequences. The biological synthesis method for increasing the accumulation of the L-5-methyltetrahydrofolate comprises the following steps: converting for accumulating an original strain of the L-5-methyltetrahydrofolate to obtain a recombinant strain by virtue of the L-5-methyltetrahydrofolate synthetase system co-expressed recombinant plasmid, and fermenting the recombinant strain. The accumulation of the L-5-methyltetrahydrofolate in the recombinant strain in a final fermentation product is remarkably higher than that of the original strain, the utilization rate of the raw material is increased, and production cost and energy consumption are reduced.

Description

technical field [0001] The invention relates to a synthesis method in the technical field of metabolic engineering, in particular to a biosynthesis method for increasing the output of L-5-methyltetrahydrofolate. Background technique [0002] L-5-methyltetrahydrofolate is also known as (6S)-5-methyltetrahydrofolate, and its chemical name is (6S)-N-[4-[[(2-amino-1,4,5,6, 7,8-Hexahydro-4-oxo-5-methyl-6-pteridinyl)methyl]amino]benzoyl]-L-glutamic acid. [0003] L-5-Methyltetrahydrofolate is the most active form of folic acid, and it is also the form of folic acid that can be directly absorbed and utilized by the human body. Ordinary folic acid can participate in the methylation process and DNA synthesis only when it is metabolized into L-5-methyltetrahydrofolate, and the bioavailability of L-5-methyltetrahydrofolate is significantly higher than that of ordinary folic acid. [0004] L-5-methyltetrahydrofolate is the only active form of folic acid in plasma and cerebrospinal cor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/72C12N15/66C12P17/18
CPCC12N15/72C12N9/0028C12N9/1014C12N15/66C12N2800/101C12N2800/60C12P17/188C12Y105/0102C12Y201/02001
Inventor许激扬卞筱泓孙天娇
OwnerCHINA PHARM UNIV