Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of a migratory locust intestinal nucleic acid hydrolase gene in pest control

A hydrolase and nucleic acid technology, applied in the directions of hydrolase, application, genetic engineering, etc., can solve the problems of restricting the application of insect-resistant dsRNA, and feeding dsRNA can not achieve the ideal effect.

Active Publication Date: 2019-06-25
SHANXI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Migratory locust, an important agricultural pest, is highly sensitive to dsRNA, but feeding dsRNA does not achieve the desired effect, which restricts the application of insect-resistant dsRNA in pest control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a migratory locust intestinal nucleic acid hydrolase gene in pest control
  • Application of a migratory locust intestinal nucleic acid hydrolase gene in pest control
  • Application of a migratory locust intestinal nucleic acid hydrolase gene in pest control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0012] Example 1: Acquisition of full-length cDNA sequence and amino acid sequence analysis of migratory locust RNase 2

[0013] 1. Obtaining the full-length cDNA sequence of migratory locust RNase 2

[0014] Based on the transcriptome database of migratory locusts, the Unigene was searched, and after NCBI Blastx analysis, it was confirmed that a fragment of RNase 2 of migratory locusts was obtained. The fragment was analyzed with GeneDoc software, and primer premier5.0 software was used to design the upstream primer ACGATGGCCTCCCTACCGCT (SEQ ID NO: 6) and the downstream primer TGTTTCACATCTGAGACGGTTAG (SEQ ID NO: 7), provided by Sangon Bioengineering (Shanghai) Co., Ltd. synthesis.

[0015] Select well-developed 5th instar migratory locust nymphs with equal size and half male and half sexes, and quickly dissect the midgut under a stereomicroscope, and freeze them in liquid nitrogen. RNA was extracted according to the TaKaRa Trizol kit. The extracted RNA was reverse-transcri...

Embodiment 2

[0018] Embodiment 2: the dsRNA of synthetic migratory locust RNase 2

[0019] 1. Design dsRNA primers of migratory locust RNase 2

[0020] Based on the migratory locust RNase 2 sequence, it was designed using primer premier5.0 software. dsRNA primers were designed, the sequences of which were taatacgactcactatagggGTCGGCTCCGACTTCTACAC (SEQ ID NO: 4) and taatacgactcactatagggAGCTCCGTCTCGACATTGTT (SEQ ID NO: 5) (the part in italics is the T7 promoter). All primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

[0021] 2. Preparation of templates for the synthesis of migratory locust RNase 2 dsRNA

[0022] The above-mentioned preserved RNase 2 plasmid was used as a template, and a PCR amplification was performed with a primer with a T7 promoter sequence synthesized to obtain a fragment with a length of 540 bp, the nucleotide sequence of which was SEQ ID NO:3. The PCR product was purified with Gel Extroaction Kit (Omega), and then quantified with NaNoDrop 2000 (Th...

Embodiment 3

[0025] Example 3: The influence of dsRNA of migratory locust RNase 2 on the stability and interference efficiency of dsRNA introduced by feeding method.

[0026]1. Injection of specific dsRNA

[0027] A total of 39 well-developed, uniformly sized, male and female 5th-instar nymphs were selected for the experiment. Gently inject 4 μl (10 μg) of synthetic RNase 2 dsRNA into the flank between the second and third abdominal segments of the nymph using a 25 μl microsyringe. At the same time, 39 nymphs were selected as the control group, and the dsRNA of GFP was injected into the control group with the same volume and concentration. The injected migratory locusts were reared in a 30°C constant temperature biochemical incubator (light:dark time=14h:10h, temperature 30±2°C, humidity 60%), and fed fresh wheat seedlings and wheat bran every day.

[0028] 2. Detection of the silencing efficiency of migratory locust RNase 2 and the influence of midgut digestive juice on the integrity of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides application of a migratory locust intestinal tract RNase gene 2 to agricultural pest prevention and control. Particularly, by a bioinformatic method, RNase 2 fragments are obtained from a migratory locust transcriptome; the cDNA full length sequence is obtained through PCR (polymerase chain reaction) amplification verification. The double-chain RNA (dsRNA) of RNase 2 is synthesized according to the design primer; after the injection into the migratory locust body cavity, the specific silencing RNase 2 can be performed; then, after the migratory locust is fed with insect-resistant gene DsRNA, the migratory locust death rate can reach 50 percent or higher; through the application of the RNase 2, the pest prevention and control through dsRNA feeding becomes possible; important practical significance can be realized on the pest prevention and control.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of migratory locust intestinal nuclease hydrolase gene 2 (RNase 2) in pest control. Background technique [0002] Insect pests are the great enemy of agricultural production. At present, pest control mainly relies on chemical control. However, the long-term application of chemical pesticides has brought about problems such as pesticide residues, environmental pollution, and insect resistance of pests. New pesticide substitutes are urgently needed to be developed. RNA interference (RNAi), a phenomenon of specific post-transcriptional gene silencing usually caused by double-stranded RNA (dsRNA) molecules, was awarded the Nobel Prize in 2006. In recent years, with the continuous deepening of research work, the use of RNAi technology for pest control has become a new strategy in the field of plant protection. In 2008, the new concept of pest control based on RNAi was pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/55C12N15/113A01N57/16A01P7/04
CPCA01N57/16C12N9/22C12N15/1137C12N2310/141
Inventor 张建珍宋慧芳张建琴刘晓健李涛马恩波
Owner SHANXI UNIV