Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

RNAi plant expression vector for inhibiting expression of cytochrome P450 gene and application thereof

A plant expression vector and cell-inhibiting technology, applied in applications, plant products, genetic engineering, etc., can solve the problems of death, inability to degrade bentazon in vivo, plant death, etc., and achieve the effect of preventing transgene escape

Active Publication Date: 2016-08-31
HAINAN BOLIAN RICE GENE TECH CO LTD
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The mutation of the CYP81A6 gene causes the above mutants to be unable to degrade bendazone in vivo, resulting in plant death when spraying bendazone herbicide
At the same time, the cytochrome P450 is also the target of sulfonylurea herbicides. Plants containing CYP81A 6 mutant gene or bendazone-sensitive plants will also cause death when sprayed with sulfonylurea herbicides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RNAi plant expression vector for inhibiting expression of cytochrome P450 gene and application thereof
  • RNAi plant expression vector for inhibiting expression of cytochrome P450 gene and application thereof
  • RNAi plant expression vector for inhibiting expression of cytochrome P450 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] The acquisition of embodiment 1 bacterial strain, plasmid and the synthesis of PCR primer

[0048] (1) Strains and plasmids

[0049] The plant binary transformation vector pTCK303 as backbone vector contains hygromycin resistance gene, maize Ubi promoter and NOS terminator; pMD18-T cloning vector (Takara). The strain of Escherichia coli is DH5α; the strain of Agrobacterium tumefacieus is EHA105.

[0050] (2) PCR primer sequence

[0051] The enzyme cutting sites of the forward primer were designed as KpnⅠ and ClaⅠ, and the restriction enzyme cutting sites of the reverse primer were XholⅠ and BamHI.

[0052] P450RNAi-F1 GGGGTACCATCGATCAGTGCACCAGAGTCACAGAAA

[0053] P450RNAi-R1CCGCTCGAGGGATCCGACATGAGGCCGACGC

Embodiment 2

[0054] Example 2 Construction and Transformation of RNAi Plant Expression Vector

[0055] In order to construct the interference vector of cytochrome P450 gene CYP81A6, rice cDNA was used as a template, and the P450i-1 gene fragment was amplified by PCR using the primers in Example 1. The amplification system and procedures are as follows:

[0056] Program: Pre-denaturation at 94°C for 5-10min, denaturation at 94°C for 30s, annealing at 57°C for 30s, extension at 72°C for 30s, 30-35 cycles, extension at 72°C for 30s; end at 16°C.

[0057]

[0058]

[0059] A gene fragment of 490bp with the expected size was amplified. After recovery, it was connected to the pMD18-T vector (Takara) and named pMD18-T-P450i-1. The sequence of the fragment was verified to be correct by sequencing. The plant binary transformation vector used is pTCK303 (such as figure 1 As shown in A), cut the pTCK303 vector and pMD18-T-P450i-1 respectively according to the enzyme cutting site, and connect ...

Embodiment 3

[0060] Embodiment 3 Agrobacterium transformed rice and identification of transgenic plants

[0061] The pTCK303-P450i-1 recombinant plasmid was introduced into the Agrobacterium EHA105 strain, and the callus of japonica rice Zhonghua 11 was transformed. After hygromycin resistance screening, differentiation, and rooting, 32 regenerated transgenic lines were obtained, and the transgenic plants were identified by PCR. The hygromycin resistance gene was introduced, and the results showed that 30 PCR positive plants ( image 3 ), the positive plants were transplanted into the soil, and 25 survived.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an RNAi plant expression vector for inhibiting expression of a cytochrome P450 gene and a construction method for same, and as well as a method of interfering in expression of a cytochrome P450 gene CYP81A6 and a method of obtaining plants with dominant sensitivity on herbicides. The RNAi plant expression vector is converted into paddy rice, so that expression of the gene CYP81A6 is successfully inhibited, and meanwhile, the paddy is turned from herbicide resistance to herbicide sensitivity, so that the paddy rice with dominant sensitivity on herbicides can be cultured. Sensitive plants can be removed by means of application of the herbicide. The vector has important application values in the fields such as cultivation of novel transgenosis varieties, production of hybrid rice seeds, prevention on transgene escape and the like.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and in particular relates to an RNAi plant expression vector for inhibiting cytochrome P450 gene expression, its construction method and application. Background technique [0002] The utilization of crop heterosis is one of the important means to increase agricultural production. Rice is one of the most important food crops in the world, with obvious heterosis. China is the first country in the world to successfully realize the commercial production of hybrid rice. Hybrid rice has increased my country's rice production by 20%. The annual planting area of ​​hybrid rice in the country has exceeded 50% of the annual planting area of ​​rice. The "three-line method" and "two-line method" are currently the main methods for hybrid rice seed production, but due to the genotype limitation of the three-line nucleoplasmic interaction and the instability of the light and temperature sensitivity of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/84A01H5/00
CPCC12N15/8218C12N15/8261
Inventor 黄培劲安保光欧阳超陈思兰吴永忠
Owner HAINAN BOLIAN RICE GENE TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com