RNAi plant expression vector for inhibiting expression of cytochrome P450 gene and application thereof
A plant expression vector and cell-inhibiting technology, applied in applications, plant products, genetic engineering, etc., can solve the problems of death, inability to degrade bentazon in vivo, plant death, etc., and achieve the effect of preventing transgene escape
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] The acquisition of embodiment 1 bacterial strain, plasmid and the synthesis of PCR primer
[0048] (1) Strains and plasmids
[0049] The plant binary transformation vector pTCK303 as backbone vector contains hygromycin resistance gene, maize Ubi promoter and NOS terminator; pMD18-T cloning vector (Takara). The strain of Escherichia coli is DH5α; the strain of Agrobacterium tumefacieus is EHA105.
[0050] (2) PCR primer sequence
[0051] The enzyme cutting sites of the forward primer were designed as KpnⅠ and ClaⅠ, and the restriction enzyme cutting sites of the reverse primer were XholⅠ and BamHI.
[0052] P450RNAi-F1 GGGGTACCATCGATCAGTGCACCAGAGTCACAGAAA
[0053] P450RNAi-R1CCGCTCGAGGGATCCGACATGAGGCCGACGC
Embodiment 2
[0054] Example 2 Construction and Transformation of RNAi Plant Expression Vector
[0055] In order to construct the interference vector of cytochrome P450 gene CYP81A6, rice cDNA was used as a template, and the P450i-1 gene fragment was amplified by PCR using the primers in Example 1. The amplification system and procedures are as follows:
[0056] Program: Pre-denaturation at 94°C for 5-10min, denaturation at 94°C for 30s, annealing at 57°C for 30s, extension at 72°C for 30s, 30-35 cycles, extension at 72°C for 30s; end at 16°C.
[0057]
[0058]
[0059] A gene fragment of 490bp with the expected size was amplified. After recovery, it was connected to the pMD18-T vector (Takara) and named pMD18-T-P450i-1. The sequence of the fragment was verified to be correct by sequencing. The plant binary transformation vector used is pTCK303 (such as figure 1 As shown in A), cut the pTCK303 vector and pMD18-T-P450i-1 respectively according to the enzyme cutting site, and connect ...
Embodiment 3
[0060] Embodiment 3 Agrobacterium transformed rice and identification of transgenic plants
[0061] The pTCK303-P450i-1 recombinant plasmid was introduced into the Agrobacterium EHA105 strain, and the callus of japonica rice Zhonghua 11 was transformed. After hygromycin resistance screening, differentiation, and rooting, 32 regenerated transgenic lines were obtained, and the transgenic plants were identified by PCR. The hygromycin resistance gene was introduced, and the results showed that 30 PCR positive plants ( image 3 ), the positive plants were transplanted into the soil, and 25 survived.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap