Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of male-sterility gene OsGEN and method for restoring fertility

A male sterility gene and male sterility technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve problems such as the limitations of restorer lines and maintainer lines, and the complex performance of three-line hybrid rice seeds.

Inactive Publication Date: 2016-09-21
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the expression of seed dominance in three-line hybrid rice is complex and limited by the restorer and maintainer lines.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of male-sterility gene OsGEN and method for restoring fertility
  • Application of male-sterility gene OsGEN and method for restoring fertility
  • Application of male-sterility gene OsGEN and method for restoring fertility

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 , the method for the creation of rice male sterile strains

[0042] 1.1 Creating osgen rice male sterile lines by means of physical mutagenesis

[0043] The sequence of the coding region of the OsGEN gene in this example is shown in SEQ ID No.2. The osgen mutation material in this example is obtained from conventional japonica rice variety Wuyujing No. 7 (also known as 9522) through conventional genetic engineering methods.

[0044] Those skilled in the art know that other means such as ray irradiation can also be used to induce mutations in rice conventional varieties, specifically including through 60 osgen mutants were obtained by Coγ-ray mutagenesis, and the treatment dose was 280Gy (reference method: Chen Liang, Chu Huangwei, Yuan Zheng, et al. 60Isolation and genetic analysis of rice mutants induced by Coγ-Ray rays[J]. Xiamen University Journal: Natural Science Edition, 2006, (S1):82-85). Backcross the mutagenized mutants for three generations to...

Embodiment 3

[0067] Example 3 recover osgen Methods for traits of male sterility in mutants

[0068] Transferring the genome nucleotide sequence encoding the OsGEN gene into the mutant osgen plant can restore the mutant to the wild-type phenotype. Specifically, the Agrobacterium tumefaciens EHA105 containing the OsGEN complementation construct is transferred into the rice male sterile line, cultivated, and obtained; wherein the OsGEN complementation construct contains the nucleoside sequence shown in SEQ ID No.5 acid.

[0069] Use primers from the rice 9522 genome:

[0070] OsGENHB-1F (its sequence is shown in SEQ ID NO.6): AATCTAGAAATTGTTGGCTGAAACACGG(XbaI)

[0071]OsGENHB-1R (its sequence is shown in SEQ ID NO.7): AACCATGGCTCCTCTTCTTCCCCGGCGAC(NcoI)

[0072] The 1976bp OsGEN-L promoter fragment was amplified, digested with endonucleases XbaI and NcoI, and connected to the rice binary vector pCAMBIA1301; after the sequence was correct, the pCAMBIA1301-OsGENpro vector was obta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention specifically relates to application of a male-sterility gene OsGEN and a method for restoring fertility, belonging to the technical field of rice breeding. The male-sterility gene OsGEN has an amino acid sequence as shown in SEQ ID No. 1. The application of the male-sterility gene OsGEN is that the OsGEN gene is knocked out, changed or inhibited by using a conventional method or based on a CRISPR / Cas9 system so as to allow the expression level of the OsGEN gene in a conventional rice variety to be decreased, and thus, a male-sterility strain of rice is obtained. The invention also relates to the method for restoring male sterility of rice caused by deletion of the OsGEN gene. According to the method, the OsGEN gene is amplified through primers, a mutant plant is transformed by using a genetic transformation means, so the mutant is restored to the phenotype of a wild type. The rice mutant obtained in the invention is free of abnormity in the phase of vegetative growth; however, a homozygote plant is completely infertile. When the mutant is applied to cross breeding, the operation of emasculation of a female parent can be omitted; production efficiency is substantially improved; labor cost is reduced; and the mutant has important application value in agricultural production.

Description

technical field [0001] The invention relates to a method for creating rice strains in the technical field of bioengineering, in particular to an application of the male sterility gene OsGEN and a method for restoring fertility. Background technique [0002] Rice is one of the main food crops in the world, and it is the most important food crop in my country. More than 60% of the people in China take rice as the staple food, and China is the largest rice producer and consumer in the world. Hybrid rice can greatly increase the yield of rice and is an important method to solve the food problem. The hybrid rice currently used in production belongs to the three-line hybrid rice, which increases the yield by about 20% compared with conventional rice. However, the expression of seed dominance in three-line hybrid rice is complicated and limited by restorer lines and maintainer lines. Therefore, scientists have been screening and breeding new sterile lines to lay the foundation f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C07K14/415C12N15/29A01H5/00C12Q1/68A01H1/02
CPCC12N15/8205A01H1/02C07K14/415C12N15/8289C12Q1/6895C12Q2600/13
Inventor 张大兵梁婉琪汪冲袁政陈明姣罗治靖
Owner SHANGHAI JIAO TONG UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More