Application of male-sterility gene OsGEN and method for restoring fertility
A male sterility gene and male sterility technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve problems such as the limitations of restorer lines and maintainer lines, and the complex performance of three-line hybrid rice seeds.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 , the method for the creation of rice male sterile strains
[0042] 1.1 Creating osgen rice male sterile lines by means of physical mutagenesis
[0043] The sequence of the coding region of the OsGEN gene in this example is shown in SEQ ID No.2. The osgen mutation material in this example is obtained from conventional japonica rice variety Wuyujing No. 7 (also known as 9522) through conventional genetic engineering methods.
[0044] Those skilled in the art know that other means such as ray irradiation can also be used to induce mutations in rice conventional varieties, specifically including through 60 osgen mutants were obtained by Coγ-ray mutagenesis, and the treatment dose was 280Gy (reference method: Chen Liang, Chu Huangwei, Yuan Zheng, et al. 60Isolation and genetic analysis of rice mutants induced by Coγ-Ray rays[J]. Xiamen University Journal: Natural Science Edition, 2006, (S1):82-85). Backcross the mutagenized mutants for three generations to...
Embodiment 3
[0067] Example 3 recover osgen Methods for traits of male sterility in mutants
[0068] Transferring the genome nucleotide sequence encoding the OsGEN gene into the mutant osgen plant can restore the mutant to the wild-type phenotype. Specifically, the Agrobacterium tumefaciens EHA105 containing the OsGEN complementation construct is transferred into the rice male sterile line, cultivated, and obtained; wherein the OsGEN complementation construct contains the nucleoside sequence shown in SEQ ID No.5 acid.
[0069] Use primers from the rice 9522 genome:
[0070] OsGENHB-1F (its sequence is shown in SEQ ID NO.6): AATCTAGAAATTGTTGGCTGAAACACGG(XbaI)
[0071]OsGENHB-1R (its sequence is shown in SEQ ID NO.7): AACCATGGCTCCTCTTCTTCCCCGGCGAC(NcoI)
[0072] The 1976bp OsGEN-L promoter fragment was amplified, digested with endonucleases XbaI and NcoI, and connected to the rice binary vector pCAMBIA1301; after the sequence was correct, the pCAMBIA1301-OsGENpro vector was obta...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
