Check patentability & draft patents in minutes with Patsnap Eureka AI!

Isoprene synthase gene and application thereof

A technology of isoprene and synthase, applied in the field of genetic engineering, can solve the problem of low efficiency of isoprene

Inactive Publication Date: 2016-10-05
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The present invention aims to solve the technical problem that the efficiency of synthesizing isoprene by engineering bacteria is not high, and provides an isoprene synthase gene with higher synthesis efficiency and its application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Isoprene synthase gene and application thereof
  • Isoprene synthase gene and application thereof
  • Isoprene synthase gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1: Obtaining of gene fragments

[0028] 1. Extraction of total RNA from leaves

[0029] Collect the leaves of the sunflower, use the RNeasy Plant Mini Kit (Qiagen company) to extract the total RNA of the poplar leaves, carry out according to the kit instructions, and carry out electrophoresis ( figure 1 ) to verify the quality of RNA extraction, it can be seen that the integrity of the RNA is good, and subsequent experiments can be performed.

[0030] 2. RT-PCR

[0031] Take Oligo(dT) 20 As a reverse transcription primer, the nucleic acid was reverse transcribed into cDNA according to the reverse transcription kit SuperScript.III First-Strand Synthesis System for RT-PCR (Invitrogen Company) instructions;

[0032] The reaction system is as follows:

[0033] RNA 1 μg

[0034] 10mM dNTP 1μl

[0035] Oligo(dT)20 (0.5μg / μl) 1μl

[0036] 65°C for 5min, place on ice for 1min, add the following 10μl mix

[0037]

[0038] 50°C for 50min, 85°C for 15min, add...

Embodiment 2

[0056] Example 2: Obtaining the full length of the ClispS gene coding region

[0057] The method for obtaining full-length cDNA is SMARTer-RACE, using PCR cDNASynthesis Kit (Clontech Company) was carried out, and the primers and reagents used below were all except GSP Provided in the PCR cDNA Synthesis Kit, follow the kit instructions.

[0058] 1. Preparation of RACE-Ready cDNA

[0059] The reverse transcription system for the first strand of RACE-Ready cDNA is as follows:

[0060]

[0061]

[0062] 2. Design of gene-specific primers:

[0063] Design gene-specific primers (GSP) according to the sequence of the obtained ClispS fragment, use RACE-Ready cDNA as a template, and use GSP and universal primer (Universal Primer Mix, UPM) as primers for amplification to obtain 3'-RACE cDNA fragments and 5'-RACE cDNA fragment. Primer position as Image 6 As shown, the black part in the middle is the sequence obtained by degenerate PCR, the black part on both sides is the u...

Embodiment 3

[0086] Embodiment 3: Construction of Escherichia coli isoprene production strain

[0087] The sequences of the full-length primers CLFa and CLRa are as follows:

[0088] CLFa: 5'AATTAACCATGGCCGGGAGCAAAGGTTG 3'

[0089] CLRa: 5' CATATGGTACCCTATATATTGCTGACCCACA 3'

[0090] 1. Construction of Escherichia coli expression vector pBAD-ClispS

[0091] The ClispS gene fragment obtained by using primers CLFa and CLRa was subjected to NcoI and KpnI double digestion with NcoI and KpnI (TAKARA Company), and the pBAD-HisB expression vector (purchased from Invitrogen Company) was subjected to NcoI and KpnI double digestion, and the ClispS gene was connected to pBAD- The HisB vector was transformed into trans5α competent cells, and positive clones were selected for sequencing. The nucleotide sequence of pBAD-ClispS is SEQ ID No.5.

[0092] 2. Construction of isoprene-producing strain MV / pClispS

[0093] The constructed pBAD-ClispS was co-transformed with the plasmids p1 and p2 into the B...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an isoprene synthase gene and an application thereof, in order to solve the technical problem that the synthesis of isoprene, with the adoption of engineering bacteria, is not high in efficiency. The invention provides the isoprene synthase gene, protein expressed by the isoprene synthase gene, a prokaryotic expression vector and an engineering bacterium containing the isoprene synthase gene as well as a preparation method for producing the isoprene engineering bacterium and an application of the isoprene engineering bacterium. The isoprene synthase gene disclosed by the invention can be widely applied to the field of preparing the isoprene.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to an isoprene synthase gene and its application. Background technique [0002] In nature, isoprene is mainly emitted into the atmosphere by certain plant leaves, while in industrial production, isoprene is mainly extracted and distilled from the C5 fraction of petroleum cracking products. However, as petroleum resources are increasingly depleted and non-renewable, the collection of isoprene released by natural plants is getting twice the result with half the effort. The production of isoprene through microbial engineering bacteria has become an inevitable trend of sustainable development. [0003] According to reports, plants release 5 million tons of isoprene into the atmosphere every year, and bacteria themselves do not have isoprene synthase genes, so plants are a good source of isoprene synthase (ISPS). Some progress has been made in the study of isoprene synthase ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/60C12N9/88C12N15/70C12N1/21C12P5/02C12R1/19
Inventor 李春赖小勤胡开蕾傅深展陶勇
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More