Colon targeting recombinant toxin as well as preparation method and application thereof
A technology for recombining toxin proteins and toxins, which is applied in the fields of peptide preparation methods, chemical instruments and methods, recombinant DNA technology, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] express rCCK 96-104 Construction of PE38KDEL Recombinant Strain
[0058] (1) Using pET-rG17PE38KDEL as a template, reverse CCK 96-104 The fragment gene is fused with the PE38KDEL gene, and rTEV-specific cleavage sites are introduced, and the artificially synthesized primers are:
[0059] F1: TTCGACATGTGGGGGCATGTATGACCATATGGCCGAAGAGGGC
[0060] F2: GCTAGC GAAAACCTGTATTTTTCAGGGCTTCGACATGTGGGGCATG
[0061] R: GGATCC TTACAGCTCGTCCTTCGGCG
[0062] PCR conditions: pre-denaturation at 94°C for 5min, denaturation at 94°C for 45s, annealing at 62°C for 30s, extension at 72°C for 1min, extension at 72°C for 10min, 32 cycles.
[0063] (2) The amplified product was identified by 1% agarose gel electrophoresis, and a bright band appeared above approximately 1000 bp. The band was recovered using a gel recovery kit and stored at -20°C.
[0064] (3) Construction of the cloning vector: Mix the recovered gene and the pMD-18T vector at a ratio of 4:1, then add an equal volume of ...
Embodiment 2
[0068] Prokaryotic expression and induction condition optimization
[0069] (1) Prokaryotic expression
[0070] The screened monoclonal recombinant engineered strains were inoculated into LB medium (Kana) with 1% inoculum, and cultured at 37°C at 180r until the bacterial solution OD 600 When it was 0.4, add the inducer IPTG to the final concentration of 1M, continue to cultivate under the same conditions for 5 hours, take 1 mL of the bacterial liquid at 4 °C, centrifuge at 10000r for 15 min, add 80 μL of PBS, 20 μL of 5×SDS-PAGE Loading Buffer, boil in water for 10 min, pass through 10 %SDS-PAGE electrophoresis verification expression (recombinant protein molecular weight 39kDa, attached figure 2 );
[0071] (2) western-blotting analysis of recombinant protein
[0072] Configure 10% SDS-PAGE electrophoresis gel, add 10 μL of the above-mentioned prepared bacterial sample to each well, and perform SDS-PAGE electrophoresis; press the transfer device from bottom to top for the...
Embodiment 4
[0085] Protein Purification Strategy
[0086] (1) Ultrasonic crushing
[0087] Induce expression according to the optimized fermentation conditions, centrifuge the bacterial solution at low temperature and high speed for 15min (10000r, 4°C), discard the supernatant, add an equal amount of PBS to resuspend, centrifuge to remove the supernatant (10000r, 4°C, 15min), repeat Twice to wash the cells. Add 15mL PBS per 1g of bacteria and resuspend with PBS (containing 1mg / mL lysozyme), and then use an ultrasonic breaker to break up the bacteria (total ultrasonic time 30min, power 380W, working time 1s, interval 4s). Centrifuge at low temperature and high speed (10000r, 4°C, 1h), discard the precipitate, filter the supernatant with a 0.22μm filter, and store it at 4°C for short-term storage;
[0088] (2) Ni-NTA affinity chromatography
[0089] Use the AKTA purifier 100 purification instrument for purification, first turn on the AKTA purifier 100 purification system, connect the chr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 