Unlock instant, AI-driven research and patent intelligence for your innovation.

Colon targeting recombinant toxin as well as preparation method and application thereof

A technology for recombining toxin proteins and toxins, which is applied in the fields of peptide preparation methods, chemical instruments and methods, recombinant DNA technology, etc.

Active Publication Date: 2016-11-09
JILIN UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Ira Pastan et al. proved that a toxin molecule can successfully inactivate 300 ribosomes within 35 minutes. In theory, a recombinant toxin molecule can kill tumor cells after binding to them. However, due to toxin internalization efficiency and intracellular Furin enzyme The impact of cleavage efficiency (the cleavage efficiency of Furin enzyme to PE is 5%-15%), killing a tumor cell requires 400-1000 toxin molecules

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Colon targeting recombinant toxin as well as preparation method and application thereof
  • Colon targeting recombinant toxin as well as preparation method and application thereof
  • Colon targeting recombinant toxin as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] express rCCK 96-104 Construction of PE38KDEL Recombinant Strain

[0058] (1) Using pET-rG17PE38KDEL as a template, reverse CCK 96-104 The fragment gene is fused with the PE38KDEL gene, and rTEV-specific cleavage sites are introduced, and the artificially synthesized primers are:

[0059] F1: TTCGACATGTGGGGGCATGTATGACCATATGGCCGAAGAGGGC

[0060] F2: GCTAGC GAAAACCTGTATTTTTCAGGGCTTCGACATGTGGGGCATG

[0061] R: GGATCC TTACAGCTCGTCCTTCGGCG

[0062] PCR conditions: pre-denaturation at 94°C for 5min, denaturation at 94°C for 45s, annealing at 62°C for 30s, extension at 72°C for 1min, extension at 72°C for 10min, 32 cycles.

[0063] (2) The amplified product was identified by 1% agarose gel electrophoresis, and a bright band appeared above approximately 1000 bp. The band was recovered using a gel recovery kit and stored at -20°C.

[0064] (3) Construction of the cloning vector: Mix the recovered gene and the pMD-18T vector at a ratio of 4:1, then add an equal volume of ...

Embodiment 2

[0068] Prokaryotic expression and induction condition optimization

[0069] (1) Prokaryotic expression

[0070] The screened monoclonal recombinant engineered strains were inoculated into LB medium (Kana) with 1% inoculum, and cultured at 37°C at 180r until the bacterial solution OD 600 When it was 0.4, add the inducer IPTG to the final concentration of 1M, continue to cultivate under the same conditions for 5 hours, take 1 mL of the bacterial liquid at 4 °C, centrifuge at 10000r for 15 min, add 80 μL of PBS, 20 μL of 5×SDS-PAGE Loading Buffer, boil in water for 10 min, pass through 10 %SDS-PAGE electrophoresis verification expression (recombinant protein molecular weight 39kDa, attached figure 2 );

[0071] (2) western-blotting analysis of recombinant protein

[0072] Configure 10% SDS-PAGE electrophoresis gel, add 10 μL of the above-mentioned prepared bacterial sample to each well, and perform SDS-PAGE electrophoresis; press the transfer device from bottom to top for the...

Embodiment 4

[0085] Protein Purification Strategy

[0086] (1) Ultrasonic crushing

[0087] Induce expression according to the optimized fermentation conditions, centrifuge the bacterial solution at low temperature and high speed for 15min (10000r, 4°C), discard the supernatant, add an equal amount of PBS to resuspend, centrifuge to remove the supernatant (10000r, 4°C, 15min), repeat Twice to wash the cells. Add 15mL PBS per 1g of bacteria and resuspend with PBS (containing 1mg / mL lysozyme), and then use an ultrasonic breaker to break up the bacteria (total ultrasonic time 30min, power 380W, working time 1s, interval 4s). Centrifuge at low temperature and high speed (10000r, 4°C, 1h), discard the precipitate, filter the supernatant with a 0.22μm filter, and store it at 4°C for short-term storage;

[0088] (2) Ni-NTA affinity chromatography

[0089] Use the AKTA purifier 100 purification instrument for purification, first turn on the AKTA purifier 100 purification system, connect the chr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to colon targeting recombinant toxin as well as a preparation method and application thereof, and belongs to the colon targeting recombinant toxin prepared by using genetic engineering. The colon targeting recombinant toxin has an amino acid sequence as shown in SEQID No.2, pET28a is used as an expression vector, and BL21(DE3) is used as an expression host, so that a BL21(DE3)(pET28a-rCCK96-104PE38KDEL) recombinant engineering bacterial strain is constructed; and 6-poly-L-histidine labels are carried, so that purification is facilitated. A Ni-NTA metal-chelating affinity column is used, and a specificity cutting method for rTEV enzymes is combined, so that only through two-step purification, rCCK96-104PE38KDEL recombination protein being high in activity, high in purity and free from redundant sequences can be obtained, and the purity is 95% or above; in vitro cell experiment, purified rCCK96-104PE38KDEL recombinant immunotoxin can specifically kill colon cancer cells with high expression, can restrain proliferation and diffusion of cancer cells, and does not have any damaging effect on normal cells and other non-CCK2R high-expression tumor cells; and therefore, the rCCK96-104PE38KDEL conforms to conditions as tumor targeting drugs, and a new direction is provided for treatment of the colon cancers.

Description

technical field [0001] The present invention relates to the preparation of colon-targeted recombinant toxin by genetic engineering, specifically the use of truncated human cholecystokinin CCK 96-104 A recombinant toxin with colon cancer targeting formed by linking with the recombinant toxin PE38KDEL derived from Pseudomonas aeruginosa exotoxin A; the recombinant toxin was prepared by genetic engineering expression; and a unique and efficient purification method was established; and its role in inhibiting the proliferation of colon cancer cells application. Background technique [0002] Colon cancer (Colorectal cancer, CRC) is one of the high incidence of human malignant tumors, and its incidence has been on the rise. The number of cases of colon cancer in the world exceeds 100 million people every year, and it has risen to the third place in the incidence of malignant tumors in the world. Its mortality ranks second in the cause of death of malignant tumors. In my country, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/70C07K1/22A61K38/16A61P35/00
Inventor 胡盼柳增善任洪林卢士英李岩松周玉张嵩柳溪林李萌常江
Owner JILIN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More