A kind of indel molecular marker and its primer and application for identifying watermelon peel texture characteristics

A molecular marker and watermelon technology, applied in the field of molecular biology, can solve problems such as the inability to determine the position and effect of a single quality/quantity trait gene, the rich variation of watermelon peel pattern characteristics, and the difficulty of comparing different studies, so as to speed up cloning and functional verification, improving selection efficiency and accuracy, and the effects of mutation stabilization

Inactive Publication Date: 2019-05-14
HENAN UNIV OF ANIMAL HUSBANDRY & ECONOMY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these genetic analyzes can only study one or more genes controlling quality / quantity traits as a whole, and cannot determine the position and effect of a single quality / quantity trait gene on the chromosome (Xu Yunbi, 1992)
With the completion of watermelon genome sequencing (Luo et al., 2013), Gama et al. (2014) discovered two SSR markers linked to the watermelon peel feature (clearly defined or diffuse), both located on chromosome 6, However, limited markers limit further mining of this locus
[0003] In addition, the characteristics of watermelon peel texture are rich in variation, but there is no unified description standard, so it is difficult to compare different studies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of indel molecular marker and its primer and application for identifying watermelon peel texture characteristics
  • A kind of indel molecular marker and its primer and application for identifying watermelon peel texture characteristics
  • A kind of indel molecular marker and its primer and application for identifying watermelon peel texture characteristics

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The method for developing the InDel molecular marker for identifying watermelon peel features, the specific steps are as follows:

[0034] (1) Preliminary mapping of genome-wide QTLs for watermelon peel texture characteristics

[0035] Using the female parent "ZXG01478" (rack) and the male parent "14CB11" (mesh bar, figure 1 ) obtained by hybridization of F 2 The population has constructed a high-density genetic linkage map (Shang et al., 2016), and the parents, F 1 and F 2 93 single melons in the population were visually identified for the characteristics of peel pattern; combined with genetic linkage map and F 2 As a result of the population phenotype identification, the Rqtl-IM-binary method (Yandel et al., 2007) was used for the initial QTL mapping, and a major QTL for the peel pattern was identified in LG6 ( RP6 ), its peak LOD is 23.65, explaining 67.78% of the phenotypic variation, the corresponding confidence interval (2-LOD) is 105.9-155.7cM, and the corre...

Embodiment 2

[0041] Watermelon F 2 Population molecular marker analysis, comprising the following steps:

[0042] (1) Extract the total DNA of leaves by CTAB method, the specific steps are as follows:

[0043] Take 1 g of fresh leaves and put them into a mortar, add liquid nitrogen to grind them into powder, then transfer them into a centrifuge tube with 1 ml of CTAB extraction solution, mix the two thoroughly, and then place them in a constant temperature water bath at 65°C for 60 min. Invert and mix 2-3 times;

[0044] After taking it out from the water bath, centrifuge at 8000 rpm for 1 min;

[0045] Take the supernatant and put it in another centrifuge tube, add an equal volume of chloroform: isoamyl alcohol (24:1, V / V), invert gently to mix well;

[0046] Centrifuge at 10,000 rpm for 5 min, and take the supernatant (try not to get the middle sediment);

[0047] Add 0.7 times the volume of isopropanol (need to pre-cool for 30 minutes in advance), mix well and freeze at -20°...

Embodiment 3

[0088] f 2 The reconstruction of population genetic linkage map, the steps are as follows: First, use the characteristic morphological marker (RP6), the newly developed InDel marker and other SNP markers on LG6 to conduct linkage analysis with Joinmap4.0 software, and find that RP6 is located in the main QTL RP6 The confidence interval of , and it is relatively close to the QTL peak position, the genetic distance between one of the newly developed markers InDel1_rp6 and RP6 is very close, only 0.2cM ( figure 2 B). We also used the SSR marker MCPI_05 (Gama, et al. 2014) linked to the characteristic of peel pattern in the published literature, as in Example 2 for F 2 The population was genotype identified, and then linkage analysis was performed using Joinmap4.0 software, and it was found that the genetic distance between MCPI_05 and RP6 was 3.1cM ( figure 2 B). So far, we have developed a QTL related to the peel texture characteristic ( RP6 ) The most closely linked co-d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an InDel molecular marker for identifying grain coating feature of watermelon peel. A nucleotide sequence is GAATTAAATATTTTGAAATAATAGTGAAAGATTAAATTGGAAAAAAAAAAGTTTCAAAAATCTAAAACAT; a primer sequence is InDel1_rp6F: TCAAATGATGCTTTTCTTTT; InDel1_rp6R: TTAACAACCGTTGATGTGAA. The InDel molecular marker has the advantages that the InDel molecular marker is closely interlocked with the grain coating feature of watermelon peel, a primer is designed, the InDel molecular marker is applied into the seed breeding of grain coating feature of watermelon peel, a new means is provided for identifying the grain coating feature of watermelon peel, the improvement process of character of grain coating feature of watermelon peel is accelerated, and the seed breeding accuracy and selection efficiency are improved.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to an InDel molecular marker for identifying watermelon peel texture characteristics, primers and applications thereof. Background technique [0002] The fruit traits of watermelon, such as skin covering pattern, fruit shape, skin color, flesh color, etc. will all affect consumers' acceptance of watermelon varieties, so they are the main goals of breeders for new varieties. Existing studies mainly focus on fruit shape, flesh color and other fruit traits, but there are few studies on the characteristics of watermelon peel texture. Xiao Guanghui (2012) reviewed the genes related to the peel pattern. The mottled peel gene m produces medium-dark green peel with green and white spots (Weetman., 1937), and the gene p controls the very narrow lines on the natural peel. The study also found that Intermittent stripe gene ins (Gusmini et al., 2006). However, these genetic analyz...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor韦小敏李娜尚建立王吉明马双武李楠楠杨雪
OwnerHENAN UNIV OF ANIMAL HUSBANDRY & ECONOMY