Universal BRCA1 gene multi-PCR (polymerase chain reaction) database creating reagent kit
A kit and gene technology, applied in the field of universal BRCA1 gene multiplex PCR library building kits
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: Primer design and preparation
[0040] Primers were provided by Ion Ampl iSeq TM Designer software design. Then the sequence TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO:85) was added at the 5' end of each forward primer; the sequence GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO:86) was added at the 5' end of each reverse primer.
[0041] Primers were synthesized by Shanghai Maojin Biotechnology Co., Ltd. After the synthesis, the primers were divided into two groups, namely group 1 and group 2. The primers and their descriptions of each group are shown in Tables 1 and 2 below:
[0042] Table 1
[0043]
[0044]
[0045]
[0046]
[0047] Table 2
[0048]
[0049]
Embodiment 2
[0050] Example 2: Genome quantification
[0051] DNA from samples such as blood, tissue, and saliva can be used for amplification. In this example, 12 samples of DNA from surgically removed breast tumor tissues were used, named BC1A01 to BC1A12 respectively. 25 mg tissue per sample, using Blood&Tissue kit (Qiagen) was used for processing, DNA was extracted, and Nanodrop quality control was performed. Refer to the Qubit manual to accurately quantify the genomic DNA of the sample, and control the DNA concentration within the range of 20-50ng / μl. If the DNA concentration after quantification is higher than 50ng / μl, use TE buffer to dilute to 50ng / μl.
Embodiment 3
[0052] Embodiment 3: PCR amplification
[0053]The following PCR reaction system and PCR program are used to amplify each genomic DNA sample obtained in Example 2, wherein, each genomic DNA sample is subjected to two PCRs in parallel, one PCR adopts the primer of Example 1 group 1, and the other PCR adopts Example group 2 primers:
[0054] (1) PCR reaction system, 25 μl, in which:
[0055]
[0056]
[0057] The enzyme was KAPA2G Robust hotstart ready mix (Kapa Biosystems).
[0058] (2) The PCR program is as follows:
[0059]
[0060] Two groups of PCR products were amplified by the above PCR method.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com