Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Universal BRCA1 gene multi-PCR (polymerase chain reaction) database creating reagent kit

A kit and gene technology, applied in the field of universal BRCA1 gene multiplex PCR library building kits

Inactive Publication Date: 2016-12-07
SHANGHAI IND TECH INST
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, the large-scale screening methods and evaluation system for BRCA1 / 2 mutations in China have not yet been established. With the rapid development of gene molecular detection, it is urgent to establish stable detection technology and standardized screening procedures, and objectively and scientifically evaluate The role of genetic variation of genes, through the detection of individual genetic susceptibility, to assess the risk of women suffering from breast cancer, and establish a molecular early warning system for breast cancer; at the same time, the BRCA1 / 2 mutation detection system can also provide new anti-tumor drugs for PARP inhibitors. Application to Breast Cancer Provides Reliable Prediction of Response

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Universal BRCA1 gene multi-PCR (polymerase chain reaction) database creating reagent kit
  • Universal BRCA1 gene multi-PCR (polymerase chain reaction) database creating reagent kit
  • Universal BRCA1 gene multi-PCR (polymerase chain reaction) database creating reagent kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Primer design and preparation

[0040] Primers were provided by Ion Ampl iSeq TM Designer software design. Then the sequence TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO:85) was added at the 5' end of each forward primer; the sequence GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO:86) was added at the 5' end of each reverse primer.

[0041] Primers were synthesized by Shanghai Maojin Biotechnology Co., Ltd. After the synthesis, the primers were divided into two groups, namely group 1 and group 2. The primers and their descriptions of each group are shown in Tables 1 and 2 below:

[0042] Table 1

[0043]

[0044]

[0045]

[0046]

[0047] Table 2

[0048]

[0049]

Embodiment 2

[0050] Example 2: Genome quantification

[0051] DNA from samples such as blood, tissue, and saliva can be used for amplification. In this example, 12 samples of DNA from surgically removed breast tumor tissues were used, named BC1A01 to BC1A12 respectively. 25 mg tissue per sample, using Blood&Tissue kit (Qiagen) was used for processing, DNA was extracted, and Nanodrop quality control was performed. Refer to the Qubit manual to accurately quantify the genomic DNA of the sample, and control the DNA concentration within the range of 20-50ng / μl. If the DNA concentration after quantification is higher than 50ng / μl, use TE buffer to dilute to 50ng / μl.

Embodiment 3

[0052] Embodiment 3: PCR amplification

[0053]The following PCR reaction system and PCR program are used to amplify each genomic DNA sample obtained in Example 2, wherein, each genomic DNA sample is subjected to two PCRs in parallel, one PCR adopts the primer of Example 1 group 1, and the other PCR adopts Example group 2 primers:

[0054] (1) PCR reaction system, 25 μl, in which:

[0055]

[0056]

[0057] The enzyme was KAPA2G Robust hotstart ready mix (Kapa Biosystems).

[0058] (2) The PCR program is as follows:

[0059]

[0060] Two groups of PCR products were amplified by the above PCR method.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a universal BRCA1 gene multi-PCR (polymerase chain reaction) database creating reagent kit, and particularly provides a primer product, a polynucleotide sequence product, a corresponding reagent kit and a BRCA1 gene multi-PCR database creating or BRCA1 gene mutation screening method. Primers in the primer product comprise primer sequences shown as SEQ ID NO:1-84. Each polynucleotide sequence in the polynucleotide sequence product contains suspension linker sequences and an optional primer sequence shown as SEQ ID NO:1-84.

Description

technical field [0001] The invention belongs to the field of detection of BRCA1 gene mutants, in particular to a universal BRCA1 gene multiplex PCR library construction kit. Background technique [0002] Breast cancer is one of the most common malignant tumors in women in the world, accounting for 23% of the total number of female cancers and 14% of female cancer deaths. Metastatic recurrence of breast cancer is an important cause of death for patients, and the median survival time after metastasis is less than 2 years. In my country, the incidence of breast cancer has been increasing year by year in recent years. Since the 1990s, the incidence of breast cancer in China has grown at more than twice the global rate, especially in urban areas. Taking Beijing and Shanghai as examples, breast cancer has ranked first among female malignant tumors for 20 consecutive years. Now the annual incidence rate has reached more than 40 / 100,000, and it is still rising at a rate of 2-3% ev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C40B50/06
CPCC12Q1/6886C12Q1/6858C12Q2600/106C12Q2600/156C12Q2600/16C40B50/06C12Q2531/113C12Q2537/143C12Q2525/191
Inventor 黄薇邵志敏施锦绣胡欣
Owner SHANGHAI IND TECH INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com