Animal-derived component detection kit
A technology for animal-derived components and detection kits, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problem of high cost, cannot be applied to civilians, and cannot comprehensively analyze and detect various animal-derived components, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] The animal-derived component detection kit of this embodiment includes a primer set and a membrane chip.
[0034] Wherein, the primer combination of the present embodiment includes 12 kinds of primer pairs, and the base sequence 5'-3' of the forward primer and reverse primer of each primer pair is as follows:
[0035] Primer pairs used to detect components of porcine origin:
[0036] Forward primer: ACCGTAGGAATAGACGTG (SEQ ID NO.1), reverse primer: TGAAGCCCAGAGCTCATAG (SEQ ID NO.2);
[0037] Primer pairs for detection of bovine-derived components:
[0038] Forward primer: TTACAACAATTTATCAACATAA (SEQ ID NO.3), reverse primer: CCGGGTCGAAGAAGGTTGTA (SEQ ID NO.4);
[0039] Primer pairs for detection of raccoon-raccoon-derived components:
[0040] Forward primer: GCCTGAAGTGTACCTCTT (SEQ ID NO.5), reverse primer: TGTGATCATGGGCTGATT (SEQ ID NO.6);
[0041] Primer pairs for detection of sheep-derived components:
[0042] Forward primer: GGCCTATACTATGGATCATATAC (SEQ ID NO.7...
Embodiment 2
[0106] The animal-derived component detection kit of this embodiment includes a primer set, a membrane chip, and auxiliary materials. Among them, the auxiliary materials include dNTPs, EX-Taq polymerase (Polymerase), positive oligonucleotide single-stranded DNA labeled with biotin at the 5' end, and PCR buffer (containing magnesium ions). The base sequence of the positive oligonucleotide single-stranded DNA is shown in SEQID NO.39. All the other are with embodiment 1.
[0107] The animal-derived component detection kit of this embodiment is used to detect the sample to be tested-sausage (purchased in the market), the detection steps are the same as in Example 1, and the detection results are as follows image 3 shown. Depend on image 3 B, it can be seen that there are spots on the position of the porcine probe on the membrane chip, and there are also spots at the position of the internal reference probe and the positive probe, indicating that the sample to be tested in this ...
Embodiment 3
[0109] The animal-derived component detection kit of this embodiment includes a primer set, a membrane chip, auxiliary materials and liquid preparation. The preparation solution includes pre-hybridization solution, hybridization solution, washing solution, blocking solution, streptavidin-labeled horseradish peroxidase and tetramethylbenzidine (TMB) chromogenic solution.
[0110] Among them, the prehybridization solution is 5×SSC, 0.1% SDS and 10×Denhardt’s; the hybridization solution is 5×SSC, 0.1% SDS, 5×Denhardt’s, 50% deionized formamide and 100 μg / ml yeast tRNA.
[0111] The lotion includes lotion 1, lotion 2, lotion 3, and lotion 4. Among them, washing solution 1: 2×SSC and 0.1% SDS, washing solution 2: 0.5×SSC and 0.1% SDS, washing solution 3: 100mM Tris-HCl, pH7.5, 150mM NaCl, washing solution 4: 100mM Tris-HCl , PH9.5, 100mM NaCl and 100mM MgCl 2 .
[0112] The blocking solution is 3% BSA, 100mM Tris-HCl, PH7.5, 150mM NaCl; the tetramethylbenzidine chromogenic solut...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
