Check patentability & draft patents in minutes with Patsnap Eureka AI!

Animal-derived component detection kit

A technology for animal-derived components and detection kits, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problem of high cost, cannot be applied to civilians, and cannot comprehensively analyze and detect various animal-derived components, etc. question

Active Publication Date: 2016-12-21
SICHUAN HUAHAN TRIO BIOTECH CO LTD
View PDF7 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, domestic and foreign reports on the detection of animal-derived components mainly include microscopy, infrared spectroscopy, ELISA, ordinary PCR, and fluorescent quantitative PCR. Analysis and detection of various animal-derived components involved in food, these methods cannot well meet the needs of rapid, large-scale, high-throughput detection
At present, the vast majority of gene chip technology is still in the laboratory stage, and it is more used for basic research rather than civilian application.
At present, the gene chip method generally uses glass slides as the solid phase support, and the corresponding sample spotting instrument and chip reader are required in the experimental process, which is costly

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Animal-derived component detection kit
  • Animal-derived component detection kit
  • Animal-derived component detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The animal-derived component detection kit of this embodiment includes a primer set and a membrane chip.

[0034] Wherein, the primer combination of the present embodiment includes 12 kinds of primer pairs, and the base sequence 5'-3' of the forward primer and reverse primer of each primer pair is as follows:

[0035] Primer pairs used to detect components of porcine origin:

[0036] Forward primer: ACCGTAGGAATAGACGTG (SEQ ID NO.1), reverse primer: TGAAGCCCAGAGCTCATAG (SEQ ID NO.2);

[0037] Primer pairs for detection of bovine-derived components:

[0038] Forward primer: TTACAACAATTTATCAACATAA (SEQ ID NO.3), reverse primer: CCGGGTCGAAGAAGGTTGTA (SEQ ID NO.4);

[0039] Primer pairs for detection of raccoon-raccoon-derived components:

[0040] Forward primer: GCCTGAAGTGTACCTCTT (SEQ ID NO.5), reverse primer: TGTGATCATGGGCTGATT (SEQ ID NO.6);

[0041] Primer pairs for detection of sheep-derived components:

[0042] Forward primer: GGCCTATACTATGGATCATATAC (SEQ ID NO.7...

Embodiment 2

[0106] The animal-derived component detection kit of this embodiment includes a primer set, a membrane chip, and auxiliary materials. Among them, the auxiliary materials include dNTPs, EX-Taq polymerase (Polymerase), positive oligonucleotide single-stranded DNA labeled with biotin at the 5' end, and PCR buffer (containing magnesium ions). The base sequence of the positive oligonucleotide single-stranded DNA is shown in SEQID NO.39. All the other are with embodiment 1.

[0107] The animal-derived component detection kit of this embodiment is used to detect the sample to be tested-sausage (purchased in the market), the detection steps are the same as in Example 1, and the detection results are as follows image 3 shown. Depend on image 3 B, it can be seen that there are spots on the position of the porcine probe on the membrane chip, and there are also spots at the position of the internal reference probe and the positive probe, indicating that the sample to be tested in this ...

Embodiment 3

[0109] The animal-derived component detection kit of this embodiment includes a primer set, a membrane chip, auxiliary materials and liquid preparation. The preparation solution includes pre-hybridization solution, hybridization solution, washing solution, blocking solution, streptavidin-labeled horseradish peroxidase and tetramethylbenzidine (TMB) chromogenic solution.

[0110] Among them, the prehybridization solution is 5×SSC, 0.1% SDS and 10×Denhardt’s; the hybridization solution is 5×SSC, 0.1% SDS, 5×Denhardt’s, 50% deionized formamide and 100 μg / ml yeast tRNA.

[0111] The lotion includes lotion 1, lotion 2, lotion 3, and lotion 4. Among them, washing solution 1: 2×SSC and 0.1% SDS, washing solution 2: 0.5×SSC and 0.1% SDS, washing solution 3: 100mM Tris-HCl, pH7.5, 150mM NaCl, washing solution 4: 100mM Tris-HCl , PH9.5, 100mM NaCl and 100mM MgCl 2 .

[0112] The blocking solution is 3% BSA, 100mM Tris-HCl, PH7.5, 150mM NaCl; the tetramethylbenzidine chromogenic solut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an animal-derived component detection kit. The kit comprises a primer combination of at least three primer pairs in primer pairs disclosed as SEQ ID NO.1-22. The kit can be used for detecting components derived from pigs, cattle, raccoon dogs, sheep, chickens, ducks, rabbits, foxes, minks, donkeys and mice, and has the characteristics of high specificity, high sensitivity and high detection result visualization degree. The animal-derived component detection kit can be judged directly with the naked eyes, is low in cost, and thus, is suitable for large-scale detection on animal-derived components of various foods.

Description

technical field [0001] The invention relates to the field of detection supplies, in particular to a detection kit for animal-derived components. Background technique [0002] In recent years, lawbreakers have appeared in the market to use cheap and low-value meat products, mix them with beef, mutton and donkey meat for sale, often use processed pork as beef, mix chicken and duck meat with beef and mutton, and use mouse, mink or fox meat to pass off as meat. Making lamb kebabs with mutton, etc., greatly damages the rights and interests of consumers, and at the same time reduces people's trust in food safety, causing adverse social impacts. At the same time, in the import and export trade of international trade, the safety hazard of animal husbandry caused by mad cow disease still exists. The notice issued by the Ministry of Agriculture, "Notice on Prohibiting the Addition and Use of Animal-derived Feed in Ruminant Feed", etc., all impose mandatory requirements on animal-deri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6888C12Q2600/16C12Q2600/166
Inventor 霍胜楠刘菲云振宇曾莲周钧李文静王锋黄广平
Owner SICHUAN HUAHAN TRIO BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More