Recombinant clostridium for efficiently producing butanol, and construction method and application of recombinant clostridium
A technology for the production of butanol and its construction method, which is applied in the field of butanol-producing Clostridium and its construction, and can solve the problems of lack of directional transformation of target proteins and little research progress
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] This embodiment includes the following steps:
[0034] (1) Construction of pIMP1-Pthl plasmid
[0035] Genomic DNA of Clostridium acetobutylicum C. acetobutylicum ATCC 824 (purchased from the American Standard Biological Collection) was extracted using Sangon Biotech (Shanghai Shenggong) Ezup Column Bacterial Genomic DNA Extraction Kit (Product No.: B518255). Primer: Pthl-F: GACAC CTGCAG TTTTTAACAAAATATATTGA (the underlined part is the restriction site of Pst I) and Pthl-R: GACAC GTC GAC TTCTTTCATTCTAACTAACCTC (the underlined part is the Sal I restriction site) amplifies the promoter sequence of thiolase from genomic DNA (see SEQ ID NO.3 for the specific sequence), and uses the PCR-amplified thiolase promoter DNA with Pst I and Sal I were double-digested, and the pIMP1 plasmid [Mermelstein L.D., Welker N.E., Bennett G.N., Papoutsakis E.T. Expression of cloned homologous fermentative genes in Clostridium acetobutylicum ATCC824.Nature Biotechnology, 1992, 10 (2): 190...
Embodiment 2
[0041] Butanol is fermented by the recombinant bacterial strain, and the present embodiment comprises the following steps:
[0042] The recombinant bacterial strain Clostridium acetobutylicum ATCC 824 (pIMT-glcG) obtained in Example 1 and the control empty plasmid bacterial strain C.acetobutylicum ATCC 824 (pIMP1) and its departure wild-type bacterial strain C.acetobutylicum ATCC 824 were inoculated respectively into the activation medium (containing 10 μg / mL erythromycin resistance), placed in an anaerobic environment for static culture, the culture temperature was 37.5 ° C, and the activation culture was used for seed culture for 20 h; v / v) The inoculum amount was inoculated in the seed medium (containing 10 μg / mL erythromycin resistance), placed in an anaerobic environment for shake flask culture, the culture temperature was 37.5°C, the rotation speed was 150rpm, and the culture was 24-30h for Anaerobic fermentation culture: Biotec-3BG-4 fermenter (Shanghai Baoxing Bio-Equi...
Embodiment 3
[0055] Butanol is fermented by the recombinant bacterial strain, and the present embodiment comprises the following steps:
[0056] The recombinant bacterial strain Clostridium acetobutylicum ATCC 824 (pIMT-glcG) obtained in Example 1 and the control empty plasmid bacterial strain C.acetobutylicum ATCC 824 (pIMP1) and its departure wild-type bacterial strain C.acetobutylicum ATCC 824 were inoculated respectively into the activation medium (containing 10 μg / mL erythromycin resistance), placed in an anaerobic environment for static culture, the culture temperature was 37.5 ° C, and the activation culture was used for seed culture for 20 h; v / v) The inoculum amount was inoculated in the seed medium (containing 10 μg / mL erythromycin resistance), placed in an anaerobic environment for shake flask culture, the culture temperature was 37.5°C, the rotation speed was 150rpm, and the culture was 24-30h for Anaerobic fermentation culture: Biotec-3BG-4 fermenter (Shanghai Baoxing Bio-Equi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


