Recombinant clostridium for efficiently producing butanol, and construction method and application of recombinant clostridium

A technology for the production of butanol and its construction method, which is applied in the field of butanol-producing Clostridium and its construction, and can solve the problems of lack of directional transformation of target proteins and little research progress

Active Publication Date: 2017-02-15
DALIAN UNIV OF TECH
View PDF4 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Although a lot of progress has been made in the understanding of the physiological metabolism and regulatory mechanism of Clostridium acetobutylicum, there is little progress in improving the substrate utilization efficiency and production intensity of butanol fermentation through strain modification, mainly due to the lack of effective targets. Targeted transformation of protein for metabolic engineering

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant clostridium for efficiently producing butanol, and construction method and application of recombinant clostridium
  • Recombinant clostridium for efficiently producing butanol, and construction method and application of recombinant clostridium
  • Recombinant clostridium for efficiently producing butanol, and construction method and application of recombinant clostridium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] This embodiment includes the following steps:

[0034] (1) Construction of pIMP1-Pthl plasmid

[0035] Genomic DNA of Clostridium acetobutylicum C. acetobutylicum ATCC 824 (purchased from the American Standard Biological Collection) was extracted using Sangon Biotech (Shanghai Shenggong) Ezup Column Bacterial Genomic DNA Extraction Kit (Product No.: B518255). Primer: Pthl-F: GACAC CTGCAG TTTTTAACAAAATATATTGA (the underlined part is the restriction site of Pst I) and Pthl-R: GACAC GTC GAC TTCTTTCATTCTAACTAACCTC (the underlined part is the Sal I restriction site) amplifies the promoter sequence of thiolase from genomic DNA (see SEQ ID NO.3 for the specific sequence), and uses the PCR-amplified thiolase promoter DNA with Pst I and Sal I were double-digested, and the pIMP1 plasmid [Mermelstein L.D., Welker N.E., Bennett G.N., Papoutsakis E.T. Expression of cloned homologous fermentative genes in Clostridium acetobutylicum ATCC824.Nature Biotechnology, 1992, 10 (2): 190...

Embodiment 2

[0041] Butanol is fermented by the recombinant bacterial strain, and the present embodiment comprises the following steps:

[0042] The recombinant bacterial strain Clostridium acetobutylicum ATCC 824 (pIMT-glcG) obtained in Example 1 and the control empty plasmid bacterial strain C.acetobutylicum ATCC 824 (pIMP1) and its departure wild-type bacterial strain C.acetobutylicum ATCC 824 were inoculated respectively into the activation medium (containing 10 μg / mL erythromycin resistance), placed in an anaerobic environment for static culture, the culture temperature was 37.5 ° C, and the activation culture was used for seed culture for 20 h; v / v) The inoculum amount was inoculated in the seed medium (containing 10 μg / mL erythromycin resistance), placed in an anaerobic environment for shake flask culture, the culture temperature was 37.5°C, the rotation speed was 150rpm, and the culture was 24-30h for Anaerobic fermentation culture: Biotec-3BG-4 fermenter (Shanghai Baoxing Bio-Equi...

Embodiment 3

[0055] Butanol is fermented by the recombinant bacterial strain, and the present embodiment comprises the following steps:

[0056] The recombinant bacterial strain Clostridium acetobutylicum ATCC 824 (pIMT-glcG) obtained in Example 1 and the control empty plasmid bacterial strain C.acetobutylicum ATCC 824 (pIMP1) and its departure wild-type bacterial strain C.acetobutylicum ATCC 824 were inoculated respectively into the activation medium (containing 10 μg / mL erythromycin resistance), placed in an anaerobic environment for static culture, the culture temperature was 37.5 ° C, and the activation culture was used for seed culture for 20 h; v / v) The inoculum amount was inoculated in the seed medium (containing 10 μg / mL erythromycin resistance), placed in an anaerobic environment for shake flask culture, the culture temperature was 37.5°C, the rotation speed was 150rpm, and the culture was 24-30h for Anaerobic fermentation culture: Biotec-3BG-4 fermenter (Shanghai Baoxing Bio-Equi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses clostridium capable of improving the utilization efficiency and the production intensity of butanol fermentation glucose maltose, and a construction method and application of the lostridium, and belongs to the technical field of biochemical industry. The clostridium comprises a glcG gene with the sequence being SEQ ID NO.1; the amino acid sequence of protein GlcG encoded by the glcG gene is SEQ ID NO.2. The construction method of the clostridium comprises the following steps: (1) constructing a glcG gene overexpression recombinant plasmid; (2) constructing a glcG gene overexpression recombinant bacterial strain; and (3) detecting the fermentation performance of the recombinant bacterial strain butanol. The invention also provides application of the clostridium capable of improving the utilization efficiency and the production intensity of butanol fermentation glucose maltose to production of butanol. The glcG gene is overexpressed in C.acetobutylicum ATCC 824, so that the utilization efficiency of the glucose maltose and the production intensity of the butanol can be obviously improved.

Description

technical field [0001] The invention relates to a recombinant clostridium capable of producing butanol efficiently and its construction method and application, in particular to a clostridium capable of producing butanol and its construction method and application. Background technique [0002] In recent years, with the depletion of global oil resources, rising world oil prices, and the deteriorating global climate, energy issues have become an urgent problem to be solved for the sustainable development of the world economy and industry. To develop new renewable, green and environmentally friendly energy, It has become one of the energy development strategies of all countries in the world. Today, biomass energy has become the fourth largest energy source in the world after oil, natural gas and coal. Because of its renewable and green advantages, it is of great significance to social and economic development and has broad application prospects. [0003] Bio-butanol, not only ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/74C12P7/16C12R1/145
CPCC07K14/00C12N9/1029C12P7/16Y02E50/10
Inventor陈丽杰吴又多薛闯白凤武
OwnerDALIAN UNIV OF TECH