Primer group for detecting renal cancer and detecting method thereof
A detection method and primer set technology, applied in the field of tumor genes, can solve the problems of lack of establishment, and achieve the effects of low cost, high sensitivity and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1: Gene selection
[0032] Many studies have shown that the sensitivity of single-gene screening is about 20-60%. Most of the single-gene tests used for early tumor screening have low detection sensitivity or specificity, which cannot meet clinical needs. Multi-gene combined detection can effectively solve the problem of low sensitivity and improve the accuracy of early tumor screening and diagnosis. In order to increase the detection rate of early tumors, improve the cure rate of tumor patients, and improve the prognosis of patients, we screened the differentially expressed genes between renal cancer and normal tissues. Through a large number of comparison experiments, we found that the genome composed of MN / CA9, TS, CYP3A4, PD-L1, VEGFR2, cadherin-6, CK19, CD24 and EPCAM has a high detection rate for kidney cancer, reaching 96%, compared to The existing detection technology has produced unexpected technical effects and has made significant progress.
Embodiment 2
[0033] Embodiment 2: primer screening
[0034] (1) Design primers a1~a3, b1~b3, c1~c3, d1~d3, e1~e3, f1~f3, g1~g3, h1~h3, i1~i3, specifically: use bioinformatics software to The A-I sequence of the target gene was analyzed, and a specific primer set was designed by using the sequence analysis software, and the specificity of each paired primer in the human genome was detected by the NCBI primer search software, and three pairs of specific amplification primers a1~a3, b1~ b3, c1~c3, d1~d3, e1~e3, f1~f3, g1~g3, h1~h3, i1~i3;
[0035] Table 1: PCR Detection Primers
[0036]
[0037]
[0038]
[0039] (2) Processing of peripheral blood samples
[0040] Peripheral blood was collected from kidney cancer patients admitted to a hospital and confirmed by pathology. At 7:00 in the morning, on an empty stomach, fresh blood was collected through the cubital vein, stored in anticoagulant tubes, shaken well, and stored at room temperature for ≤4 hours.
[0041] 2.1 Add an equal vo...
Embodiment 3
[0073] Example 3: Effect Verification
[0074] According to the screening results in Example 2, 100 tumor samples were tested using the primer sets described in the table below.
[0075]
[0076] Among them, the forward primer of CD10 is TGATGATAAGAATTCTGTGA, the reverse primer is GCAAGCTGGTTTTCATCGAT, the forward primer of N-cadherin is CCTTAACTGAGGAGTCAGTG, the reverse primer is CAGACCTGATCCTGACAAGC, the forward primer of Vimentin is CGTGACGTACGTCAGCAATA, and the reverse primer is AAGGGCATCCACTTCACAGG.
[0077] The detection rates of primer sets 1 to 8 are shown in the table above. It can be seen from the table that, in the primer set, as the number of primers increases, the detection rate can be improved to a certain extent. Further, by comparing primer sets No. 5 to No. 8, it can be found that the combination in the primer set has an important influence on the detection rate. At the same time, under the same number of detected genes, the detection rate of primer set No...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


