Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer group for detecting renal cancer and detecting method thereof

A detection method and primer set technology, applied in the field of tumor genes, can solve the problems of lack of establishment, and achieve the effects of low cost, high sensitivity and strong specificity

Inactive Publication Date: 2017-02-15
ZHEJIANG UNIV +2
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, the standard of RT-PCR method for the detection of CTCs in renal cancer has not been established

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group for detecting renal cancer and detecting method thereof
  • Primer group for detecting renal cancer and detecting method thereof
  • Primer group for detecting renal cancer and detecting method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Gene selection

[0032] Many studies have shown that the sensitivity of single-gene screening is about 20-60%. Most of the single-gene tests used for early tumor screening have low detection sensitivity or specificity, which cannot meet clinical needs. Multi-gene combined detection can effectively solve the problem of low sensitivity and improve the accuracy of early tumor screening and diagnosis. In order to increase the detection rate of early tumors, improve the cure rate of tumor patients, and improve the prognosis of patients, we screened the differentially expressed genes between renal cancer and normal tissues. Through a large number of comparison experiments, we found that the genome composed of MN / CA9, TS, CYP3A4, PD-L1, VEGFR2, cadherin-6, CK19, CD24 and EPCAM has a high detection rate for kidney cancer, reaching 96%, compared to The existing detection technology has produced unexpected technical effects and has made significant progress.

Embodiment 2

[0033] Embodiment 2: primer screening

[0034] (1) Design primers a1~a3, b1~b3, c1~c3, d1~d3, e1~e3, f1~f3, g1~g3, h1~h3, i1~i3, specifically: use bioinformatics software to The A-I sequence of the target gene was analyzed, and a specific primer set was designed by using the sequence analysis software, and the specificity of each paired primer in the human genome was detected by the NCBI primer search software, and three pairs of specific amplification primers a1~a3, b1~ b3, c1~c3, d1~d3, e1~e3, f1~f3, g1~g3, h1~h3, i1~i3;

[0035] Table 1: PCR Detection Primers

[0036]

[0037]

[0038]

[0039] (2) Processing of peripheral blood samples

[0040] Peripheral blood was collected from kidney cancer patients admitted to a hospital and confirmed by pathology. At 7:00 in the morning, on an empty stomach, fresh blood was collected through the cubital vein, stored in anticoagulant tubes, shaken well, and stored at room temperature for ≤4 hours.

[0041] 2.1 Add an equal vo...

Embodiment 3

[0073] Example 3: Effect Verification

[0074] According to the screening results in Example 2, 100 tumor samples were tested using the primer sets described in the table below.

[0075]

[0076] Among them, the forward primer of CD10 is TGATGATAAGAATTCTGTGA, the reverse primer is GCAAGCTGGTTTTCATCGAT, the forward primer of N-cadherin is CCTTAACTGAGGAGTCAGTG, the reverse primer is CAGACCTGATCCTGACAAGC, the forward primer of Vimentin is CGTGACGTACGTCAGCAATA, and the reverse primer is AAGGGCATCCACTTCACAGG.

[0077] The detection rates of primer sets 1 to 8 are shown in the table above. It can be seen from the table that, in the primer set, as the number of primers increases, the detection rate can be improved to a certain extent. Further, by comparing primer sets No. 5 to No. 8, it can be found that the combination in the primer set has an important influence on the detection rate. At the same time, under the same number of detected genes, the detection rate of primer set No...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer group for detecting the renal cancer and a detecting method thereof. The primers provided by the invention consist of SEQ ID No.1 to SEQ ID No.18; the combined detection can be performed on MN / CA9, TS, CYP3A4, PD.L1, VEGFR2, cadherin-6, CK19, CD24 and EPCAM genes. The target gene expression and the expression level can be sensitively detected in short time by a PCR (polymerase chain reaction) or fluorescent quantitation PCR method; the optimized PCR conditions are adopted ; through increasing the cycle number of amplification reaction, the observation result is more obvious; the method applicability is further improved; the amplification product has specificity; high accuracy and sensitivity of PCR and RT-PCR fluorescent quantitative detection are ensured. When the primer group for detecting the renal cancer is implemented, the renal cancer can be simply, conveniently and accurately diagnosed by detecting the target gene expression in patient samples.

Description

technical field [0001] The invention relates to the field of tumor genes, in particular to a primer set and a detection method for detecting kidney cancer. Background technique [0002] Renal cancer is a malignant tumor originating from the urinary tubular epithelial system of the renal parenchyma. With the advancement of science, the incidence of RCC has increased compared to before. The main complaints and clinical manifestations of RCC patients are changeable, and it is easy to be misdiagnosed as other diseases. The location of the kidney is hidden, and the main connection with the outside world is urine. Therefore, hematuria is the most common symptom of renal cancer. However, hematuria can only occur after the tumor invades the renal pelvis, so it is no longer an early symptom. Therefore, early diagnosis of renal cell carcinoma is very necessary. [0003] The current diagnostic methods of RCC include imaging examination, cytopathological and histopathological diagnosi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886C12Q2600/158
Inventor 徐以兵朱莉莉张大宏何强寿鑫朱珍芳
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com