Fucosyltransferase, genetically engineered bacteria thereof and application
A technology of genetically engineered bacteria and fucosyl, applied in the direction of genetic engineering, transferase, application, etc., can solve the problems of limiting the large-scale synthesis and preparation of oligosaccharides, and the inability to express active forms, etc., to achieve strong substrate specificity, Time and cost saving effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] (1) will encode fucosyltransferase slfuct The gene codon was optimized and synthesized by Biomatik (USA), and the fucosyltransferase slfuct Cloned into pBSK(+) Simple-Amp vector. Using primers GATCCATATGGCGAACATGCGTGC and AAGGGATCCTTACAGACGAGCCGG from the gene containing slfuct Amplified in pBSK(+)Simple-Amp slfuct The polynucleotide sequence of the PCR amplification condition is as follows, and the target gene fragment with a size of 1062 bp was obtained ( figure 1 ). The restriction enzyme cutting site of NdeI / BamHI introduced by PCR method is used for slfuct Subsequent ligation, the gene slfuct In addition, it was cloned into the expression vector pET15b (Novagen, UK) encoding the N-terminal His-tag to obtain the recombinant expression vector pET15b-slfuct ( figure 2 ).
[0021] PCR amplification conditions were as follows: pre-denaturation at 94°C for 4 min, denaturation at 94°C for 45 s, annealing at 58°C for 45 s, extension at 72°C for 90 s, a total...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com