Unlock instant, AI-driven research and patent intelligence for your innovation.

Fucosyltransferase, genetically engineered bacteria thereof and application

A technology of genetically engineered bacteria and fucosyl, applied in the direction of genetic engineering, transferase, application, etc., can solve the problems of limiting the large-scale synthesis and preparation of oligosaccharides, and the inability to express active forms, etc., to achieve strong substrate specificity, Time and cost saving effect

Inactive Publication Date: 2017-02-22
FUJIAN AGRI & FORESTRY UNIV
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

α-1,2-fucosyltransferases are widely found in vertebrates, invertebrates, plants, and bacteria, but most of these enzymes cannot be expressed in active form in bacterial systems, which greatly limits the ability of oligosaccharides large-scale synthetic preparation of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fucosyltransferase, genetically engineered bacteria thereof and application
  • Fucosyltransferase, genetically engineered bacteria thereof and application
  • Fucosyltransferase, genetically engineered bacteria thereof and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] (1) will encode fucosyltransferase slfuct The gene codon was optimized and synthesized by Biomatik (USA), and the fucosyltransferase slfuct Cloned into pBSK(+) Simple-Amp vector. Using primers GATCCATATGGCGAACATGCGTGC and AAGGGATCCTTACAGACGAGCCGG from the gene containing slfuct Amplified in pBSK(+)Simple-Amp slfuct The polynucleotide sequence of the PCR amplification condition is as follows, and the target gene fragment with a size of 1062 bp was obtained ( figure 1 ). The restriction enzyme cutting site of NdeI / BamHI introduced by PCR method is used for slfuct Subsequent ligation, the gene slfuct In addition, it was cloned into the expression vector pET15b (Novagen, UK) encoding the N-terminal His-tag to obtain the recombinant expression vector pET15b-slfuct ( figure 2 ).

[0021] PCR amplification conditions were as follows: pre-denaturation at 94°C for 4 min, denaturation at 94°C for 45 s, annealing at 58°C for 45 s, extension at 72°C for 90 s, a total...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses fucosyltransferase, genetically engineered bacteria thereof and an application, belongs to the technical field of gene engineering, and relates to nucleic acid and amino acid sequences from Sideroxydans lithotrophicus ES-1. Codes represent novel alpha-1, 2-fucosyltransferase SlFucT, the fucosyltransferase SlFucT obtained by separation constructs an expression vector pET15b-slfuct, and the expression vector is converted into an Escherichia coli expression strain BL21 (DE3) to realize efficient expression. The invention further provides a method for generating fucosylation oligose by alpha-1, 2-fucosyltransferase, and particularly provides an application and a method of discovering the fucosylation oligose in breast milk. The application and the method have application prospects in the field of food and medical industry.

Description

technical field [0001] The invention relates to a fucosyltransferase and its genetic engineering bacteria and application, belonging to the technical field of bioengineering. Background technique [0002] With the rapid development of biotechnology and food industry, the research and development of functional oligosaccharides has become the frontier direction in the field of international biotechnology, mainly focusing on polysaccharides from natural plants and microorganisms, which are degraded by acid and alkali to prepare low molecular weight oligosaccharides. The oligosaccharide industry has now become an emerging industry used in food, medicine, agriculture, and chemical industries. The market is large, and the global annual sales of oligosaccharides exceed 500 million US dollars. Human milk oligosaccharides have physiological effects such as regulating intestinal flora, enhancing immunity, anti-viral infection, reducing inflammation, and promoting brain development of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N15/54C12N15/10C12P19/18
CPCC12N9/1051C12P19/18
Inventor 赵超林雅静周景雪严新刘斌
Owner FUJIAN AGRI & FORESTRY UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More