Araneus ventricosus egg-case silk protein full-length gene and preparation method thereof
A full-length gene and silk protein technology, which is applied in the field of the full-length gene and preparation of silk protein from the ovum of the large belly spider, can solve the problem that the silk formation mechanism of the natural spider silk group is unclear, the yield and performance are not as good, and the large-scale silkworm cannot be Breeding and other problems, to achieve the effect of easy operation, mild conditions and simple process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] (1) According to the conserved sequence of the NT end and CT end of Tusp1 of other spiders, one degenerate primer was designed at the NT end and CT end respectively: NT end degenerate primer: ATGGTHTGGCTNATNAG, CT end degenerate primer: ANGCNGCDATNCCYTC, and in Design one specific forward primer and one specific reverse primer for the repeat region, specific forward primer: TCAAGTAGCAGTGCCTCC;
[0043] Specific reverse primer: CAAACGAGGAGGCCAGGGAAC; then perform PCR under the conditions of pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30s, annealing at 53°C for 30s, extension at 72°C for 30s, and 30 cycles.
[0044](2) According to the obtained sequence, two specific primers and one anchor primer were designed respectively at the NT end and CT end to complement the NT end and CT end.
[0045] NT end-specific primer 1: TGTTATAGGCTTAGGTGGCGTTGC;
[0046] NT end-specific primer 2: GAAGGTATTGCA GCCCTCTTGCAAG;
[0047] CT specific primer 1: GGAGATCTGGTGA...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap