Araneus ventricosus egg-case silk protein full-length gene and preparation method thereof

A full-length gene and silk protein technology, which is applied in the field of the full-length gene and preparation of silk protein from the ovum of the large belly spider, can solve the problem that the silk formation mechanism of the natural spider silk group is unclear, the yield and performance are not as good, and the large-scale silkworm cannot be Breeding and other problems, to achieve the effect of easy operation, mild conditions and simple process

Active Publication Date: 2017-03-08
DONGHUA UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But until now, the large-scale production and bionic applications of spider silk still face some challenges, mainly in: 1. Spiders are carnivores, live alone, and cannot be cultivated on a large scale like silkworms; 2. The components of natural spider silk and its silk formation The mechanism is still unclear; 3. The expression of spidroin in heterologous hosts by genetic engineering is considered to be the most promising method so far
But there are also

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Araneus ventricosus egg-case silk protein full-length gene and preparation method thereof
  • Araneus ventricosus egg-case silk protein full-length gene and preparation method thereof
  • Araneus ventricosus egg-case silk protein full-length gene and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] (1) According to the conserved sequence of the NT end and CT end of Tusp1 of other spiders, one degenerate primer was designed at the NT end and CT end respectively: NT end degenerate primer: ATGGTHTGGCTNATNAG, CT end degenerate primer: ANGCNGCDATNCCYTC, and in Design one specific forward primer and one specific reverse primer for the repeat region, specific forward primer: TCAAGTAGCAGTGCCTCC;

[0043] Specific reverse primer: CAAACGAGGAGGCCAGGGAAC; then perform PCR under the conditions of pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30s, annealing at 53°C for 30s, extension at 72°C for 30s, and 30 cycles.

[0044](2) According to the obtained sequence, two specific primers and one anchor primer were designed respectively at the NT end and CT end to complement the NT end and CT end.

[0045] NT end-specific primer 1: TGTTATAGGCTTAGGTGGCGTTGC;

[0046] NT end-specific primer 2: GAAGGTATTGCA GCCCTCTTGCAAG;

[0047] CT specific primer 1: GGAGATCTGGTGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an araneus ventricosus egg-case silk protein full-length gene and a preparation method thereof. The gene sequence is shown as SEQ ID NO.1. The preparation method comprises the following steps that a degenerate PCR (Polymerase Chain Reaction) method is used for amplifying NT and CT of the partial egg-case silk protein gene; the anchoring PCR is used for complementing the NT and the CT; a primer used for PCR amplification of the full length Tusp1 gene is designed according to the sequence obtained through sequence testing; a fragment obtained through amplification is subjected to TA cloning; the positive cloned bacteria comprising the full-length Tusp1 gene are subjected to plasmid extraction; full-length sequence testing is performed to obtain the araneus ventricosus egg-case silk protein full-length gene. The whole gene provided by the invention comprises the complete NT end, a repeated region and the complete CT end, and is used for coding the araneus ventricosus egg-case silk protein; the silk fiber has the better mechanical property and biocompatibility than silk and artificial fiber; in addition, no pollution is caused on the environment; the foundation is laid for the large-scale production of the araneus ventricosus protein in gene engineering.

Description

technical field [0001] The invention belongs to the field of spider silk proteins, and in particular relates to a full-length gene of spider silk protein and a preparation method thereof. Background technique [0002] Spider silk is a natural protein silk fiber with excellent mechanical properties, such as high strength, light texture, good elasticity, high and low temperature resistance, and good biological compatibility. Its various qualities are superior to silk and the current stage. Synthetic fibers. Due to its huge potential application value, it can be used in aerospace, military and biomedical fields in the future. But until now, the large-scale production and bionic applications of spider silk still face some challenges, mainly in: 1. Spiders are carnivores, live alone, and cannot be cultivated on a large scale like silkworms; 2. The components of natural spider silk and its silk formation The mechanism is still unclear; 3. The expression of spidroin in heterologo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/12C12N15/10
CPCC07K14/43518C12N15/10
Inventor 温睿孟清
Owner DONGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products