Method for preparing pro-brain natriuretic peptide epitope by virtue of Bacillus brevis (B.brevis)
A technology of Bacillus brevis and antigenic epitopes, applied in the direction of microorganism-based methods, biochemical equipment and methods, chemical instruments and methods, etc., can solve the problems of high cost, complexity, poor stability, etc., and achieve high-efficiency expression and simplified separation Purification process, high practical value effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] 1. Human fibronectin Fn3 displays NT-BNP 12-21 Construction of expression vector for linear epitope fusion protein:
[0029] (1) Using human fibronectin type III domain protein (Fn3) as the model gene (EMBL accession number AJ320527), NT-BNP 12-21 The linear epitope was designed in the FG region of Fn3, and the short peptide sequence encoding the BNP epitope (CTGGAAACCTCGGGCCTGCAGGAACAACGT, encoding the 12-21 amino acid residues LETSGLQEQR of BNP) was introduced in the FG loop region, and Nanjing GenScript Biotechnology Co., Ltd. was entrusted to follow the sequence List [1] Synthesis of Fn3-BNP 12-21 Gene, introduce a separation and purification tag encoding 6 histidines at the 5'end of the fusion gene to facilitate separation and purification; see the attached fusion gene structure figure 1 ;
[0030] (2) The above fusion gene Fn3-BNP 12-21 Constructed into shuttle vector pNCMO through NcoⅠ and XhoⅠ restriction sites 2 Downstream of the strong P2 promoter, forming a fusion ...
Embodiment 2
[0039] 1. Human fibronectin Fn3 displays NT-BNP 12-21 Construction of expression vector for linear epitope fusion protein:
[0040] (1) Using human fibronectin type III domain protein (Fn3) as the model gene (EMBL accession number AJ320527), NT-BNP 12-21 The linear epitope was designed in the FG region of Fn3, and the short peptide sequence encoding the BNP epitope (CTGGAAACCTCGGGCCTGCAGGAACAACGT, encoding the 12-21 amino acid residues LETSGLQEQR of BNP) was introduced in the FG loop region, and Nanjing GenScript Biotechnology Co., Ltd. was entrusted to follow the sequence List [1] Synthesis of Fn3-BNP 12-21 Gene, introduce a separation and purification tag encoding 6 histidines at the 5'end of the fusion gene to facilitate separation and purification; see the attached fusion gene structure figure 1 ;
[0041] (2) The above fusion gene Fn3-BNP 12-21 Constructed into shuttle vector pNCMO through NcoⅠ and XhoⅠ restriction sites 2 Downstream of the strong P2 promoter, forming a fusion ...
Embodiment 3
[0050] 1. Human fibronectin Fn3 displays NT-BNP 12-21 Construction of expression vector for linear epitope fusion protein:
[0051] (1) Using human fibronectin type III domain protein (Fn3) as the model gene (EMBL accession number AJ320527), NT-BNP 12-21 The linear epitope was designed in the FG region of Fn3, and the short peptide sequence encoding the BNP epitope (CTGGAAACCTCGGGCCTGCAGGAACAACGT, encoding the 12-21 amino acid residues LETSGLQEQR of BNP) was introduced in the FG loop region, and Nanjing GenScript Biotechnology Co., Ltd. was entrusted to follow the sequence List [1] Synthesis of Fn3-BNP 12-21 Gene, introduce a separation and purification tag encoding 6 histidines at the 5'end of the fusion gene to facilitate separation and purification; see the attached fusion gene structure figure 1 ;
[0052] (2) The above fusion gene Fn3-BNP 12-21 Constructed into shuttle vector pNCMO through NcoⅠ and XhoⅠ restriction sites 2 Downstream of the strong P2 promoter, forming a fusion ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap