Check patentability & draft patents in minutes with Patsnap Eureka AI!

Recombinant vector for promoting BNP (Brain Natriuretic Peptide) protein overexpression, construction method of recombinant vector, and adeno-associated virus for promoting BNP protein overexpression

A technology of recombinant vector and construction method, which is applied in the direction of single-stranded DNA virus, virus, virus/bacteriophage, etc., can solve the problems of difficulty and high cost, achieve the effects of wide host range, treatment of heart failure, and cost reduction

Inactive Publication Date: 2017-03-29
IMMUNE CELL BIOTECH CO LTD +1
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In order to solve the difficulty and high cost of directly obtaining BNP in the prior art, the present invention provides a recombinant vector for promoting the overexpression of BNP protein, its construction method and adenovirus, and the packaged adenovirus has low immunogenicity , wide host range, high safety, one-time long-term expression, stable expression, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant vector for promoting BNP (Brain Natriuretic Peptide) protein overexpression, construction method of recombinant vector, and adeno-associated virus for promoting BNP protein overexpression
  • Recombinant vector for promoting BNP (Brain Natriuretic Peptide) protein overexpression, construction method of recombinant vector, and adeno-associated virus for promoting BNP protein overexpression
  • Recombinant vector for promoting BNP (Brain Natriuretic Peptide) protein overexpression, construction method of recombinant vector, and adeno-associated virus for promoting BNP protein overexpression

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Construction of pAAV-TRE3G-P2A-GFP vector

[0037] The PCR primers for PCR amplification include an upstream primer and a downstream primer. The sequence of the upstream primer is: GCGTGAAGACGGCGCGCCTTACCCGGGGAGCATGTCAAGG, which is SEQ NO1;

[0038] The reaction system for PCR amplification is:

[0039]

[0040] PCR reaction conditions include: 98°C for 2min; 98°C for 20s, 64°C, 20s, 72°C, 1min, 2 cycles; 98°C for 20s, 62°C, 20s, 72°C, 1min, 2 cycles; 98°C for 20s, 60°C ℃, 20s, 72°C, 1min, 2 cycles; 98°C, 20s, 58°C, 20s, 72°C, 1min, 28 cycles; 72°C, 10min, 4°C storage.

[0041] The construction of pAAV-TRE3G-P2A-GFP vector comprises the following steps:

[0042] 1) Using the pZIP-TRE3G vector as a template to obtain PCR amplification products through PCR amplification and BbsI digestion;

[0043] The BbsI digestion system includes: BbsI enzyme 1ul, water 14ul, PCR product 15ul, 37°C enzyme digestion for 2 hours, gel recovery of about 1800bp fragments to ob...

Embodiment 2

[0049] Embodiment two promotes the construction of the recombinant vector of BNP protein overexpression

[0050] The construction method of the recombinant vector that promotes BNP protein overexpression comprises the steps:

[0051] S1 Construct the pAAV-TRE3G-P2A-GFP vector as in Example 1;

[0052] Obtaining the S2BNP coding sequence: Obtained from the CH837314 template by AsiSI and MluI digestion, the gene number corresponding to the CH837314 template is NM_002521, purchased from Shandong Weizhen Biotechnology Co., Ltd.;

[0053] S3 connects the BNP coding sequence and the pAAV-TRE3G-P2A-GFP vector under the action of T4 ligase, and the relevant steps are as in step 3 of Example 1) transforming the single clone to extract the plasmid, and the sequencing verification is correct, which is promoted Recombinant vector for overexpression of BNP protein, the map is as follows figure 2 shown.

Embodiment 3

[0054] Embodiment three doxycycline regulation (Tet-on) verification

[0055] Take 60ul DMEM and 2ul VGF (purchased from Shandong Weizhen Biotechnology Co., Ltd.) to make Mix 1, and let it stand for more than 5 minutes; take 60ul DMEM and 0.5ug of the recombinant vector that promotes the overexpression of BNP protein prepared in Example 2 to make Mix 2. Mix Mix 1 and Mix 2, shake and mix well, centrifuge and let stand for 30 minutes to obtain a mixed solution. Spread HEK293 cells in a 24-well plate during the static period, and the number of cells is about 1×10 5 pcs / hole. Add the resting mixture dropwise to the cells in the 24-well plate, and place in CO 2 cultured in an incubator.

[0056] Add 0ng, 5ng, 50ng, and 100ng of doxycycline hydrochloride respectively 6 hours after transfection, and take pictures after 18 hours. The results are as follows: image 3 As shown, the left one is the result of fluorescence condition, the right one is the result of bright field condit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Login to View More

Abstract

The invention provides a recombinant vector for promoting BNP (Brain Natriuretic Peptide) protein overexpression. The recombinant vector for promoting the BNP protein overexpression belongs to the field of biotechnology, and comprises a BNP coding sequence and a pAAV-TRE3G-P2A-GFP vector. The pAAV-TRE3G-P2A-GFP vector comprises AsiSI and MluI restriction enzyme cutting sites; and the BNP sequence is forward inserted into the restriction enzyme cutting sites. The recombinant vector for promoting the BNP protein overexpression provided by the invention has the advantages of high transfection efficiency, capability of promoting the BNP protein overexpression and continuously stable expression, and is simple in construction method.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a recombinant vector for promoting the overexpression of BNP protein, a construction method thereof and an adeno-associated virus. Background technique [0002] Adeno-associated virus (adeno-associated virus, AAV), also known as adeno-associated virus, belongs to the genus of Parvoviridae and is the simplest single-stranded DNA-deficient virus found so far. It needs helper virus (usually adenovirus) ) participates in replication, has the advantages of high safety, low immunogenicity, wide host range, stable expression, and stable physical properties, and has been widely used. [0003] In 1992, Goseen et al. successfully constructed a tetracycline (Tet) eukaryotic gene regulatory expression system using prokaryotic gene regulatory elements. At present, this system has been widely used in the research of gene function and gene therapy, the most widely used is Tet-on regula...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/16C12N15/864C12N15/66C12N7/01
CPCC07K14/58C12N7/00C12N15/86C12N2750/14143
Inventor 孙秀莲
Owner IMMUNE CELL BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More