Recombinant vector for promoting BNP (Brain Natriuretic Peptide) protein overexpression, construction method of recombinant vector, and adeno-associated virus for promoting BNP protein overexpression
A technology of recombinant vector and construction method, which is applied in the direction of single-stranded DNA virus, virus, virus/bacteriophage, etc., can solve the problems of difficulty and high cost, achieve the effects of wide host range, treatment of heart failure, and cost reduction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 Construction of pAAV-TRE3G-P2A-GFP vector
[0037] The PCR primers for PCR amplification include an upstream primer and a downstream primer. The sequence of the upstream primer is: GCGTGAAGACGGCGCGCCTTACCCGGGGAGCATGTCAAGG, which is SEQ NO1;
[0038] The reaction system for PCR amplification is:
[0039]
[0040] PCR reaction conditions include: 98°C for 2min; 98°C for 20s, 64°C, 20s, 72°C, 1min, 2 cycles; 98°C for 20s, 62°C, 20s, 72°C, 1min, 2 cycles; 98°C for 20s, 60°C ℃, 20s, 72°C, 1min, 2 cycles; 98°C, 20s, 58°C, 20s, 72°C, 1min, 28 cycles; 72°C, 10min, 4°C storage.
[0041] The construction of pAAV-TRE3G-P2A-GFP vector comprises the following steps:
[0042] 1) Using the pZIP-TRE3G vector as a template to obtain PCR amplification products through PCR amplification and BbsI digestion;
[0043] The BbsI digestion system includes: BbsI enzyme 1ul, water 14ul, PCR product 15ul, 37°C enzyme digestion for 2 hours, gel recovery of about 1800bp fragments to ob...
Embodiment 2
[0049] Embodiment two promotes the construction of the recombinant vector of BNP protein overexpression
[0050] The construction method of the recombinant vector that promotes BNP protein overexpression comprises the steps:
[0051] S1 Construct the pAAV-TRE3G-P2A-GFP vector as in Example 1;
[0052] Obtaining the S2BNP coding sequence: Obtained from the CH837314 template by AsiSI and MluI digestion, the gene number corresponding to the CH837314 template is NM_002521, purchased from Shandong Weizhen Biotechnology Co., Ltd.;
[0053] S3 connects the BNP coding sequence and the pAAV-TRE3G-P2A-GFP vector under the action of T4 ligase, and the relevant steps are as in step 3 of Example 1) transforming the single clone to extract the plasmid, and the sequencing verification is correct, which is promoted Recombinant vector for overexpression of BNP protein, the map is as follows figure 2 shown.
Embodiment 3
[0054] Embodiment three doxycycline regulation (Tet-on) verification
[0055] Take 60ul DMEM and 2ul VGF (purchased from Shandong Weizhen Biotechnology Co., Ltd.) to make Mix 1, and let it stand for more than 5 minutes; take 60ul DMEM and 0.5ug of the recombinant vector that promotes the overexpression of BNP protein prepared in Example 2 to make Mix 2. Mix Mix 1 and Mix 2, shake and mix well, centrifuge and let stand for 30 minutes to obtain a mixed solution. Spread HEK293 cells in a 24-well plate during the static period, and the number of cells is about 1×10 5 pcs / hole. Add the resting mixture dropwise to the cells in the 24-well plate, and place in CO 2 cultured in an incubator.
[0056] Add 0ng, 5ng, 50ng, and 100ng of doxycycline hydrochloride respectively 6 hours after transfection, and take pictures after 18 hours. The results are as follows: image 3 As shown, the left one is the result of fluorescence condition, the right one is the result of bright field condit...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Titer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



