Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of rice FAH gene in rice fertility control

A technology of rice and genes, applied in the field of genetic engineering applications

Inactive Publication Date: 2017-05-10
HUNAN AGRICULTURAL UNIV
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no research report on rice FAH gene controlling fertility

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of rice FAH gene in rice fertility control
  • Application of rice FAH gene in rice fertility control
  • Application of rice FAH gene in rice fertility control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Example 1 Cloning and sequence analysis of rice FAH gene cDNA

[0017] Rice Nipponbare seeds were germinated at 37°C for 1 day, then sown in the greenhouse, and the leaves of three-leaf stage rice were taken to extract RNA. RNA was extracted using RNAiso Plus reagent from Dalian TAKARA Company. The specific operation steps were as follows: ① Take 100 mg of rice leaves, grind them into powder with liquid nitrogen, add 1 ml of RNAiso Plus solution, mix well, place at room temperature for 5 min, and centrifuge at 12,000 rpm / min. 5min, take the supernatant; ②add 200ul chloroform to the supernatant, mix well, let stand at room temperature for 5min, centrifuge at 12000rpm / min for 10min, take the supernatant; ③add 500ul isopropanol, mix well, Let stand at room temperature for 10 minutes, centrifuge at 12000rpm / min for 15 minutes, and take the precipitate; ④ wash the precipitate twice with 500ul 75% ethanol; RNA was reverse-transcribed into cDNA using the ReverTraAce qPCR RT M...

Embodiment 2

[0019] Example 2 Expression Analysis of FAH Gene in Different Rice Tissues

[0020] Using the roots, stems, leaves and young panicles of rice Nipponbare at the booting stage as materials, the expression levels of FAH gene in different tissues of rice were analyzed.

[0021] The RNA extraction and reverse transcription method of the root, stem, leaf and young ear of rice Nipponbare at the booting stage are the same as in Example 1. Fluorescent quantitative PCR was used to analyze the expression level of FAH gene in different tissues. According to the cloned FAH gene sequence, fluorescent quantitative PCR primers OSFAH1 (5'-CGCCAGGAAACGCTCAAC-3', see SEQ ID No.5) and OSFAH2 (5'-GTCGCTCATGGGAACAAGG-3', see SEQ ID No.6) were designed. Using OSFAH1 and OSFAH2 as primers, RNA reverse transcription products of various rice tissues as templates, the reaction system was 20ul (template 400ng, OSFAH1 and OSFAH2 each 0.8ul, fluorescent quantitative reagent FastStart Universal SYBR Green ...

Embodiment 3

[0022] Example 3 Identification of FAH gene interference expression transgenic rice

[0023] In order to further identify the function of the FAH gene in the development of rice young panicles, the present invention constructed an interference expression vector of the FAH gene, transformed the rice Nipponbare, and observed the fertility of the FAH interference-expressed transgenic rice. Specific steps are as follows:

[0024]A. According to the sequence of the rice FAH gene that has been cloned (as shown in SEQ ID No.3), adopt Premier 5 software to design specific primer P1 (CAGCTTGTTGCAAGGGT, see SEQ ID No.9) and P2 (GACTTCAAATAAGTTCTTATTGTAAC, see SEQ ID No .10), using the cloned FAH gene as a template, use the high-fidelity enzyme TransStart FastPfu DNA Polymerase (TRNAsGen) to PCR amplify the FAH gene sequence, and the PCR reaction system is 25ul, including 5×TransStart FastPfu Buffer 5ul, 2.5mM dNTP 2.5ul , 10mM primer P1 1ul, 10mM primer P2 1ul, rice FAH gene cDNA 10ng,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering application, and particularly relates to the application of a rice FAH gene in rice fertility control. Expression analysis for the rice FAH gene shows that the gene has an extremely high expression quantity in a rice young panicle; after being connected and recombined with a plant interference expression vector, the gene is transferred into rice Nipponbare, that the expression level of the gene in transgenetic rice is reduced and the pollen viability of the transgenetic rice is reduced are found, so that infertility of the plant is realized. Therefore, by expression interference with the gene in the rice, the expression level of the gene in the rice is reduced, and male sterile transgenetic rice can be obtained, and the sterile line can be used for producing hybrid rice.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering application, and relates to the application of rice FAH gene in controlling rice fertility, in particular to creating rice male sterile materials by inhibiting the expression of rice FAH gene. Background technique [0002] Rice is an important food crop, and its production is of great significance to the supply of food in our country. The promotion of hybrid rice has greatly increased the yield of rice, and to some extent relieved the pressure of the rapid increase in food demand from my country's rapid population growth. Hybrid rice is to select excellent rice varieties with certain genetic differences as parents, and use "three-line method" or "two-line method" to produce hybrids with heterosis. Hybrids are superior to their parents in terms of yield, growth vigor, vitality, and fecundity. The "three-line method" is the use of sterile lines, maintainer lines and restorer lines for ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29A01H5/00
CPCC07K14/415C12N15/8218C12N15/8289
Inventor 任春梅黄丽华胡超
Owner HUNAN AGRICULTURAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com