Detection probe for SNP (Single Nucleotide Polymorphism) of human CYP2C19 gene and application of detection probe
A CYP2C19 and detection probe technology, applied in the field of nucleotide and gene molecular detection, can solve the problems of inability to accurately detect CYP2C19 gene polymorphism, inconvenience, low sensitivity and specificity of CYP2C19 gene polymorphism
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0091] The CYP2C19 gene was obtained from NCBI GenBank, and the reference sequence number is NG 008384.2.
[0092] Because the SNP detection is the sequence on the genome, but the CYP2C19 gene on the genome has introns, the sequence is widely distributed, and the length is about 90,000bp. The following only lists the mRNA sequence of the CYP2C19 gene after transcription and processing, 1709bp, and the sequence is as follows:
[0093] GTCTTAACAAGAGGAGAAGGCTTCAATGGATCCTTTTGTGGTCCTTGTGCTCTGTCTCTCATGTTTGCTTCTCCTTTCAATCTGGAGACAGAGCTCTGGGAGAGGAAAACTCCCTCCTGGCCCCACTCCTCTCCCAGTGATTGGAAATATCCTACAGATAGATATTAAGGATGTCAGCAAATCCTTAACCAATCTCTCAAAAATCTATGGCCCTGTGTTCACTCTGTATTTTGGCCTGGAACGCATGGTGGTGCTGCATGGATATGAAGTGGTGAAGGAAGCCCTGATTGATCTTGGAGAGGAGTTTTCTGGAAGAGGCCATTTCCCACTGGCTGAAAGAGCTAACAGAGGATTTGGAATCGTTTTCAGCAATGGAAAGAGATGGAAGGAGATCCGGCGTTTCTCCCTCATGACGCTGCGGAATTTTGGGATGGGGAAGAGGAGCATTGAGGACCGTGTTCAAGAGGAAGCCCGCTGCCTTGTGGAGGAGTTGAGAAAAACCAAGGCTTCACCCTGTGATCCCACTTTCATCCTGGGCTGTGCTCCCTGCAATGT...
Embodiment 2
[0123] The singleness of the melting curve of the PCR product can reflect the singleness of the product, and the singleness of the product indicates that the primer has good specificity. The specificity of designed primers was determined by melting curve method.
[0124] ① Genomic DNA extraction: Take 0.5ml of EDTA anticoagulated whole blood from the subject, use Qiagen GenemicBloodKit to extract whole blood DNA, strictly follow the kit instructions, and store the extracted DNA samples at -20°C. centrifugal.
[0125] ②The specific primers described in the experiment are the specific upstream primers and downstream primers (SEQ ID NO:1 and SEQ ID NO:2) of the CYP2C19 gene CYP2C19*2 polymorphism; the specific upstream primers of the CYP2C19*3 polymorphism of the CYP2C19 gene Primers and downstream primers (SEQ ID NO:5 and SEQ ID NO:6); specific upstream primers and downstream primers (SEQ ID NO:9 and SEQ ID NO:10) of CYP2C19 gene CYP2C19*17 polymorphism.
[0126] The PCR react...
Embodiment 3
[0136] Take 8 peripheral whole blood samples of subjects randomly selected as an example.
[0137] Using the method of the present invention to detect the CYP2C19*2 gene polymorphism, CYP2C19*3 gene polymorphism and CYP2C19*17 gene polymorphism of a certain subject is as follows: first obtain the peripheral blood sample of the clinical subject, Quickly extract genomic DNA; then prepare the fluorescent quantitative PCR reaction solution of CYP2C19*2 gene polymorphism, CYP2C19*3 gene polymorphism and CYP2C19*17 gene polymorphism, and carry out fluorescent quantitative PCR detection samples. The instrument collects the fluorescent signals of CY5 and JOE. Only the CY5-labeled Taqman probe amplification is wild type, and only the JOE-labeled Taqman probe amplification is mutant type. Both CY5-labeled Taqman probe amplification and JOE The labeled Taqman probe amplification is heterozygous, so the sample will always have positive probe amplification, and there is no need to add an i...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

