Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection probe for SNP (Single Nucleotide Polymorphism) of human CYP2C19 gene and application of detection probe

A CYP2C19 and detection probe technology, applied in the field of nucleotide and gene molecular detection, can solve the problems of inability to accurately detect CYP2C19 gene polymorphism, inconvenience, low sensitivity and specificity of CYP2C19 gene polymorphism

Inactive Publication Date: 2017-05-24
北京一立科技发展有限公司
View PDF1 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The sensitivity and specificity of direct sequencing and qualitative PCR electrophoresis identification are not high, and the CYP2C19 gene polymorphism cannot be accurately detected, which is not conducive to predicting drug efficacy and guiding drug selection
In addition, most direct sequencing currently uses outsourced experiments, and the detection time is too long, generally taking more than 48 hours, which brings inconvenience to the rapid detection of CYP2C19 gene polymorphisms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection probe for SNP (Single Nucleotide Polymorphism) of human CYP2C19 gene and application of detection probe
  • Detection probe for SNP (Single Nucleotide Polymorphism) of human CYP2C19 gene and application of detection probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0091] The CYP2C19 gene was obtained from NCBI GenBank, and the reference sequence number is NG 008384.2.

[0092] Because the SNP detection is the sequence on the genome, but the CYP2C19 gene on the genome has introns, the sequence is widely distributed, and the length is about 90,000bp. The following only lists the mRNA sequence of the CYP2C19 gene after transcription and processing, 1709bp, and the sequence is as follows:

[0093] GTCTTAACAAGAGGAGAAGGCTTCAATGGATCCTTTTGTGGTCCTTGTGCTCTGTCTCTCATGTTTGCTTCTCCTTTCAATCTGGAGACAGAGCTCTGGGAGAGGAAAACTCCCTCCTGGCCCCACTCCTCTCCCAGTGATTGGAAATATCCTACAGATAGATATTAAGGATGTCAGCAAATCCTTAACCAATCTCTCAAAAATCTATGGCCCTGTGTTCACTCTGTATTTTGGCCTGGAACGCATGGTGGTGCTGCATGGATATGAAGTGGTGAAGGAAGCCCTGATTGATCTTGGAGAGGAGTTTTCTGGAAGAGGCCATTTCCCACTGGCTGAAAGAGCTAACAGAGGATTTGGAATCGTTTTCAGCAATGGAAAGAGATGGAAGGAGATCCGGCGTTTCTCCCTCATGACGCTGCGGAATTTTGGGATGGGGAAGAGGAGCATTGAGGACCGTGTTCAAGAGGAAGCCCGCTGCCTTGTGGAGGAGTTGAGAAAAACCAAGGCTTCACCCTGTGATCCCACTTTCATCCTGGGCTGTGCTCCCTGCAATGT...

Embodiment 2

[0123] The singleness of the melting curve of the PCR product can reflect the singleness of the product, and the singleness of the product indicates that the primer has good specificity. The specificity of designed primers was determined by melting curve method.

[0124] ① Genomic DNA extraction: Take 0.5ml of EDTA anticoagulated whole blood from the subject, use Qiagen GenemicBloodKit to extract whole blood DNA, strictly follow the kit instructions, and store the extracted DNA samples at -20°C. centrifugal.

[0125] ②The specific primers described in the experiment are the specific upstream primers and downstream primers (SEQ ID NO:1 and SEQ ID NO:2) of the CYP2C19 gene CYP2C19*2 polymorphism; the specific upstream primers of the CYP2C19*3 polymorphism of the CYP2C19 gene Primers and downstream primers (SEQ ID NO:5 and SEQ ID NO:6); specific upstream primers and downstream primers (SEQ ID NO:9 and SEQ ID NO:10) of CYP2C19 gene CYP2C19*17 polymorphism.

[0126] The PCR react...

Embodiment 3

[0136] Take 8 peripheral whole blood samples of subjects randomly selected as an example.

[0137] Using the method of the present invention to detect the CYP2C19*2 gene polymorphism, CYP2C19*3 gene polymorphism and CYP2C19*17 gene polymorphism of a certain subject is as follows: first obtain the peripheral blood sample of the clinical subject, Quickly extract genomic DNA; then prepare the fluorescent quantitative PCR reaction solution of CYP2C19*2 gene polymorphism, CYP2C19*3 gene polymorphism and CYP2C19*17 gene polymorphism, and carry out fluorescent quantitative PCR detection samples. The instrument collects the fluorescent signals of CY5 and JOE. Only the CY5-labeled Taqman probe amplification is wild type, and only the JOE-labeled Taqman probe amplification is mutant type. Both CY5-labeled Taqman probe amplification and JOE The labeled Taqman probe amplification is heterozygous, so the sample will always have positive probe amplification, and there is no need to add an i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a detection probe for an SNP (Single Nucleotide Polymorphism) of a human CYP2C19 gene. A detection primer consists of a specific upstream and downstream primer pair of the gene and a specific Taqman double fluorescent probe which are respectively used for correspondingly detecting SNPs at CYP2C19*2, CYP2C19*3 and CYP2C19*17 sites. The detection probe has the characteristics of quick detection and high specificity; furthermore, the detection method is simple; positive contrast and negative contrast which are necessary to conventional fluorescent quantitation PCR are eliminated, so that the operation steps and the experimental cost are reduced; the subsequent clinical treatment strategy can be guided more quickly and better.

Description

technical field [0001] The invention belongs to the field of nucleotide and gene molecule detection, in particular to a detection probe for human CYP2C19 gene polymorphism including CYP2C19*2, CYP2C19*3 and CYP2C19*17 sites and application thereof. [0002] technical background [0003] SNP (Single Nucleotide Polymorphism, SNP) mainly refers to the DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. In genomic DNA, any base may be mutated, so SNP may be in the gene sequence or in the non-coding sequence outside the gene. There are relatively few SNPs (coding SNPs, cSNPs) located in the coding region. From the perspective of the impact on the genetic traits of organisms, cSNPs can be divided into two types: one is synonymous cSNPs, that is, changes in coding sequences caused by SNPs and It does not affect the amino acid sequence of the protein it translates, and the mutated base has the same meaning as the unmutated base; the other is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6883C12Q2600/106C12Q2600/156
Inventor 邢江峰
Owner 北京一立科技发展有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com