I-group 4-type fowl adenovirus DNA vaccine and application thereof

A DNA vaccine, avian adenovirus technology, applied in recombinant DNA technology, antiviral agents, medical preparations containing active ingredients, etc. The effect of chemical development prospects

Inactive Publication Date: 2017-05-31
TIANJIN RINGPU BIO TECH
View PDF6 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The present invention aims at the technical defect of prior art, provides a kind of I group 4 type poultry adenovirus DNA vaccine and its application, to solve the I group 4 poultry adenovirus vaccine of prior art to I group 4 type poultry adenovirus Immune to poor technical issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • I-group 4-type fowl adenovirus DNA vaccine and application thereof
  • I-group 4-type fowl adenovirus DNA vaccine and application thereof
  • I-group 4-type fowl adenovirus DNA vaccine and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] 1.1 Fibrin C-terminal gene cloning and sequence analysis:

[0027] Design and synthesize a pair of primers:

[0028] Primer 1: 5'AAACATATGTCGAGCTCGGTACCTTT 3';

[0029] Primer 2: 5'AAACTCGAGTTATGTAAAGGGAATGG 3'.

[0030] The virulent strain of FAV-4 was isolated from diseased broilers.

[0031] Using the FAV-4 virus as a template, denaturation at 94°C for 45s, annealing at 56°C for 45s, and extension at 72°C for 1min, a total of 30 cycles of PCR amplification were performed; the PCR product was directly cloned into the pMD-18T vector (TaKaRa Company) to construct pMD-18T-FAV4C: Sequencing was carried out by the dideoxy chain termination method, and the results showed that the gene encoding the C-terminus of fibrin cloned from the FAV-4 genome was shown in SEQ ID No.1. The gene was codon-optimized according to the codon preference of chickens, and the optimized FAV-4-C gene was shown in SEQ ID No.2, and the gene was synthesized onto the pMD-18T vector to construct pMD...

Embodiment 2

[0042] A DNA vaccine of group I type 4 avian adenovirus, the antigen of the vaccine contains the C-terminal expression gene of fibrin of group I type 4 adenovirus.

[0043] On the basis of the above technical solutions, the following conditions are met:

[0044] The C-terminal expression gene of the fibrin protein of group I type 4 avian adenovirus is a product obtained by replacing chicken rare codons with chicken biased codons on the basis of the natural expression genes.

Embodiment 3

[0046] A DNA vaccine of group I type 4 avian adenovirus, the antigen of the vaccine contains the C-terminal expression gene of fibrin of group I type 4 adenovirus.

[0047] On the basis of the above technical solutions, the following conditions are met:

[0048] The expression gene at the C-terminal end of the fibrin of the group I group 4 avian adenovirus is the DNA whose sequence is shown in SEQ ID No.2.

[0049] The antigen is prepared by the following method:

[0050] 1) Using the DNA fragments shown in SEQ ID No.3 and SEQ ID No.4 as primers and FAV-4 virus as a template, denature at 94°C for 45s, anneal at 56°C for 45s, and extend at 72°C for 1min for a total of 30 PCR amplification is carried out in cycles; the PCR product is directly cloned into the pMD-18T vector to obtain the recombinant vector pMD-18T-FAV4C;

[0051] 2) Optimizing the nucleotide sequence of the FAV-4-C gene to the state shown in SEQ ID No.2, and synthesizing the gene into the pMD-18T vector to obta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an I-group 4-type fowl adenovirus DNA vaccine and application thereof. According to the technical scheme, based on experimental means, research finds and shows that fiber protrusions have good immunity prototypes, in this way, with 4-type fowl adenovirus fibrous protein C-terminal genes being antigen substances, codon optimization is carried out on the basis of a natural sequence, an eukaryotic expression vector pCAGGS is cloned, and the DNA vaccine pCAGoptiFAV4C is constructed. According to the researched fowl adenovirus NDA vaccine, a method of gene engineering fermentation is adopted for preparing antigens, and therefore the I-group 4-type fowl adenovirus DNA vaccine is low in cost, pure in antigen and safe to use. By the utilization of a serology method and an immunity virus attack method, the immunity effect of the vaccine is evaluated. The result shows that the vaccine can provide effective immune protection for fowl, and has good commercial development prospects. Compared with a traditional vaccine, the DNA vaccine achieves the safety of subunit vaccines and inactivated vaccines, and also has the features of simultaneous induction of humoral immunity and cellular immune response, wherein the features only belong to attenuated vaccines or recombinant vaccines.

Description

technical field [0001] The invention relates to the technical field of biological products, in particular to a DNA vaccine research and development technology, in particular to a group I type 4 poultry adenovirus DNA vaccine and its application. Background technique [0002] Group I avian adenoviruses make up the genus Avian Adenovirus in the family Adenoviridae. Group I avian adenoviruses are distributed worldwide, and poultry of all ages are susceptible. It can spread both horizontally and vertically. Although the virulence of the 12 serotypes infected chickens was different among and within the serotypes, all 12 serotypes could induce inclusion body hepatitis (IBH). The main clinical symptoms of hydropericardial hepatitis syndrome (HHS) caused by FAdV-4 are decreased egg production and death (mortality rate is 20% to 80%), and the main pathological change is pale yellow clear effusion in the pericardial cavity , Enlarged, pale liver, enlarged kidneys, multiple focal ne...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/235A61P1/16A61P31/20C12N15/85
Inventor唐荣宏李亚杰杨保收付旭彬梁武
OwnerTIANJIN RINGPU BIO TECH