Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant bacterium and application of recombinant bacterium to generation of rebaudioside D by catalyzing rebaudioside A

A technology of recombinant bacteria and recombinant plasmids, applied in the field of genetic engineering, can solve the problems of high cost of enzyme production, large amount of recombinant bacteria, high energy consumption for preparation, and high cost, and achieves a simplified process, better environmental friendliness, and reduced costs. Effect

Active Publication Date: 2017-05-31
XINGHUA GL STEVIA CO LTD
View PDF7 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Recombinant cells are used in the reaction system, and toluene or other cell permeabilizing agents need to be added; or recombinant cell lyophilized powder is used, and the preparation of lyophilized powder consumes energy and costs high; in addition, additional UDP is required as the UDP-glucose regeneration system. Cosubstrate
Although the patent CN201410019981.4 has optimized the process of CN201310353500.9, it is still necessary to adjust the addition ratio of UDP-glycosyltransferase and sucrose synthase, the amount of recombinant bacteria is large, and the cost of enzyme production is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacterium and application of recombinant bacterium to generation of rebaudioside D by catalyzing rebaudioside A
  • Recombinant bacterium and application of recombinant bacterium to generation of rebaudioside D by catalyzing rebaudioside A
  • Recombinant bacterium and application of recombinant bacterium to generation of rebaudioside D by catalyzing rebaudioside A

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Construction of recombinant strain S1

[0024]The gene sequence of tomato-derived glycosyltransferase UGTSL2 is shown in SEQ.NO.1, and the gene sequence of potato-derived sucrose synthase StSUS1 is shown in SEQ.NO.2, which were synthesized by Nanjing GenScript after codon optimization. Primers GGGAATTCCATATGGCGACCAACCTGCG and CCGCTCGAGTTAGTGGTGATGATGGTGATGTTTG were designed to amplify the UGTSL2 gene, and the gene was subcloned into pRSFDuet-1 (Novagen) between the NdeI and XhoI sites to construct the recombinant plasmid pRSFDuet-SL2; primers were designed for TAATAAGGAGATATACCATGGCCGAACGTGTCCTGACCC and AGGCGCGTCGAGCTCGA The one-step cloning kit (One Step Cloning Kit, Vazyme) of Science and Technology Co., Ltd. subcloned the StSUS1 gene into the NcoI and EcoRI sites of pRSFDuet-SL2 to construct the recombinant plasmid pRSFDuet-SL2-SUS1. Using pRSFDuet-SL2-SUS1 as a template, primers CATGCCATGGCCGAACGTGTC and CCGGAATTCTTATTCAGCTGCCAGCG were designed, and the St...

Embodiment 2

[0025] Example 2 Construction of Recombinant Bacteria S2

[0026] Using the recombinant plasmid pRSFDuet-SL2-SUS1 constructed in Example 1 as a template, design primers AAGGAAAAAAGCGGCCGCTATGGCGACCAACCTGC and CCGGAATTCGTGGTGATGATGGTGATGTTTGCTC to amplify the UGTSL2 gene, and subclone it between the NotI and EcoRI sites of pET22b(+) (Novagen) to construct a recombinant Plasmid pET22b-SL2. Transform pRSFDuet-SL2-SUS1 and pET22b-SL2 into Escherichia coli BL21 (DE3) to obtain recombinant strain BL21 (pRSFDuet-SL2-SUS1, pET22b-SL2), referred to as S2.

Embodiment 3

[0027] Example 3 Construction of Recombinant Bacteria S3

[0028] The pRSFDuet-SL2 and pET22b-SUS1 constructed in Example 1 were transformed into Escherichia coli BL21 (DE3) to obtain the recombinant strain BL21 (pRSFDuet-SL2, pET22b-SUS1), referred to as S3.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant bacterium and application of the recombinant bacterium to the generation of rebaudioside D by catalyzing rebaudioside A. The recombinant bacterium contains a tomato-derived glycosyltransferase UGTSL2 gene and a potato-derived sucrose synthase StSUS1 gene; the tomato-derived glycosyltransferase UGTSL2 gene is cloned between NdeI and XhoI sites of pRSFDuet-1 to construct a recombinant plasmid pRSFDuet-SL2; then the potato-derived sucrose synthase StSUS1 gene is cloned between NcoI and EcoRI sites of the pRSFDuet-SL2 to construct a recombinant plasmid pRSFDuet-SL2-SUS1; the recombinant plasmid pRSFDuet-SL2-SUS1 is transferred into a host cell to obtain the recombinant bacterium. After the recombinant bacterium is subjected to induction expression, the recombinant bacterium is added into a reaction mixture to catalyze the rebaudioside A to generate the rebaudioside D; in reaction, crude enzyme liquid obtained by crushing the recombinant bacterium is utilized and separation and purification of an enzyme are avoided; lyophilized powder does not need to be produced; UDP (Uridine Diphosphate) or UDP-glucose and any cell penetration agent or other chemical reagents do not need to be added into a reaction solution, so that the recombinant bacterium has a better environment-friendly property. The yield of the rebaudioside D can reach 10.8g / L.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a recombinant bacterium and its application in catalyzing rebaudioside A to generate rebaudioside D. Background technique [0002] With the increasing awareness of people's health concerns, consumers gradually reduce the intake of sucrose, and the food industry is committed to the development of natural sweeteners with low calorie value and high sweetness. Stevioside is extracted from the perennial Compositae herb Stevia rebaudiana native to Paraguay and Brazil in South America. It has the characteristics of high sweetness (250-300 times that of sucrose), low calorie (only 1 / 300 of sucrose), and non-toxic It has no side effects, no carcinogens, is safe to eat, and has certain pharmacological effects and auxiliary curative effects on diseases such as hypertension, diabetes, obesity, heart disease, and dental caries. It is the third natural sucrose substitut...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12P19/56C12R1/19
CPCC12N9/1051C12N9/1062C12P19/56C12Y204/01013
Inventor 李艳周芳芳陈可泉严明郝宁欧阳平凯
Owner XINGHUA GL STEVIA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com