A kind of cellulose synthase pccesa1 protein from Phytophthora capsici and its coding gene and application
A cellulose synthase, coding technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve problems such as restricting control effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0072] Example 1. Acquisition of cellulose synthase pccesa1 gene and analysis of its expression at the RNA level
[0073] 1. Acquisition of cellulose synthase pccesa1 gene
[0074] 1. Using the genomic DNA of Phytophthora capsici strain Hd11 as a template, cDNA was obtained by reverse transcription;
[0075] 2. Using the cDNA of Phytophthora capsici strain Hd11 as a template, the following primers were used for PCR amplification: forward primer: ACCCCGGATTCTAGAACTAGTGGATCCCCCATGTTCAACAAGGATCAACCAG and reverse primer: AAATTGACCTTGAAAATATAAATTTTCCCCCGCCCTCCACAGGCTTC to obtain PCR amplification products. and sequence it.
[0076] Sequencing results showed that: PCR amplification obtained a PCR amplification product with a size of 3048bp, and its deoxyribonucleotide sequence was shown in sequence 1 in the sequence table, and the gene shown in sequence 1 was named pccesa1, wherein, from the 5' end ORFs 1-3048 encode a protein consisting of 1015 amino acid residues, the protein is...
Embodiment 2
[0102] Example 2, Heterologous expression and biochemical function analysis of Phytophthora capsici PCCESA1 protein
[0103] 1. Heterologous expression and purification of PCCESA1 protein
[0104] 1. Heterologous expression of PCCESA1 protein
[0105] The pccesa1 gene shown in Sequence 1 in the Sequence Listing was connected into pDDGFP-2 (GFP-8 His-containing vector) by homologous recombination to obtain an expression vector. The specific steps are as follows: linearize the pDDGFP-2 (GFP-8His-containing vector) vector with SmaI endonuclease to obtain the linearized vector; -1 Linearized vector, 5 μL 150ng μL -1 The PCR amplified product obtained in step 1 of Example 1 (the sequence of the PCR amplified product is shown in sequence 3, the 5' and 3' most end sequences of the amplified product are respectively the same as the sequences at the two ends of the linearized vector identical) and 42 μL μL ddH 2 O mixed to obtain 50 μL DNA mix system. 50 μL of DNA mix was transfer...
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


