Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

EGFR (Epidermal Growth Factor Receptor)/L858R mutant liquid biopsy kit and application thereof

An L858R, liquid biopsy technology, applied in the biological field, can solve the problems of inability to obtain tumor tissue molecular detection, the sensitivity needs to be improved, and the tumor tissue is insufficient, so as to achieve the effects of cheap detection, fast detection, and simple operation.

Inactive Publication Date: 2017-05-31
陈超
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in clinical practice, about 10% to 15% of patients with advanced non-small cell lung cancer do not undergo molecular testing due to insufficient tumor tissue or inability to obtain tumor tissue
Some prospective studies have shown that compared with tumor tissue, the detection of EGFR mutations in blood circulating tumor DNA (ctDNA) also has higher specificity, but the sensitivity needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • EGFR (Epidermal Growth Factor Receptor)/L858R mutant liquid biopsy kit and application thereof
  • EGFR (Epidermal Growth Factor Receptor)/L858R mutant liquid biopsy kit and application thereof
  • EGFR (Epidermal Growth Factor Receptor)/L858R mutant liquid biopsy kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Design of primers for detection of EGFR gene L858R mutation and its specificity and sensitivity verification.

[0035] 1. Query the target gene sequence: the identification number of the L858R mutant of EGFR in the NCBI SNP database is: rs121434568 (CATGTCAAGATCACAGATTTTGGGC[G / T]GGCCAAACTGCTGGGTGCGGAAGAG), where the wild type is T, the mutant is G, and the amino acid after mutation is L [Leu ] into R[Arg], forming a missense mutation.

[0036] 2. Design qPCR primers: reference figure 1 According to the qPCR design principle, oligo7 molecular software was used to design the upstream primer TGAAAACACCGCAGCATGTCA; the downstream L858R mutant enrichment amplification primer: GCACCCAGCAGTTTGGCTC; the downstream L858R wild type enrichment amplification primer: GCACCCAGCAGTTTGGCGA. Since the second base at the 3' end of the downstream primer is non-complementary to the template, only primers whose first base at the 3' end is complementary to the template can generat...

Embodiment 2

[0042] Example 2 is used for the detection of clinical samples by the EGFR / L858R mutation liquid biopsy kit.

[0043] 1. DNA extraction: Take 1 ml of whole blood, centrifuge at 2000 rpm for 10 min, transfer the supernatant to a new centrifuge tube; repeat the centrifugation, transfer the remaining supernatant to the centrifuge tube, and add 50 μl of mesoporous nano-magnetic beads; Regulate Na with NaCl + concentration to 0.4mol / L, vortex for 1 min; absorb at room temperature for 10 min; gently vortex the centrifuge tube for 5 sec, immediately place it on a magnetic adsorption rack, let it stand for 5 sec, and discard the liquid; wash with 300 μl ( 0.4 mol / L NaCl), repeat the above steps twice; open the lid and dry for 10 min, add 100 μl of deionized water, vortex and shake to mix, 65 ℃ water bath for 10 min; vortex the centrifuge tube for 10 sec, and immediately place it under magnetic force Put it on the adsorption rack, let it stand for 5 sec, absorb the liquid and store...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an EGFR gene L858R mutant liquid biopsy kit and application thereof. The EGFR gene L858R mutant liquid biopsy quantitative detection kit is characterized by comprising an EGFR gene upstream primer, an EGFR mutant gene downstream enrichment primer (a wild blocking primer), an EGFR wild gene downstream enrichment primer (a mutant blocking primer), a qPCR reaction system reagent and mutant and wild type EGFR positive plasmids. The kit disclosed by the invention can be used for relative quantification of mutant target genes of minimally invasive liquid biopsy of cancer patients and achieves important clinical effects on early screening, auxiliary diagnosis, recurrence monitoring and therapeutic effect evaluation of tumors. In addition, because use of a probe is not involved in the invention, the kit is low in cost and can be popularized on a large scale, and the liquid biopsy cost is reduced.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an EGFR / L858R mutation liquid biopsy kit and its application. Background technique [0002] Epidermal growth factor receptor (EGFR) is the expression product of the proto-oncogene C-erbB-1 (HER-1) located on the short arm of human chromosome 7, and is a member of the epidermal growth factor receptor family (HER). One of the four members, consisting of 188307 bases, including 28 exons, its tyrosine kinase domain is encoded by exons 18-24. Abnormal EGFR signal transduction can lead to the occurrence of various tumors, such as colorectal cancer, breast cancer, pancreatic cancer, prostate cancer and non-small cell lung cancer. [0003] Mutations in the coding region of the EGFR gene mainly occur in exons 18-21. About 60 types of EGFR gene mutations have been reported, of which 29 mutations are the most common, including 19 types of 19 (exon number) Del, 3 types of 20 Ins and 21L858R, 2...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6851C12Q1/6886C12Q2600/156C12Q2531/113
Inventor 陈超孙青唐玉玲孙塬覃晓云宋燕燕李志鹏
Owner 陈超
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com