EGFR (Epidermal Growth Factor Receptor)/L858R mutant liquid biopsy kit and application thereof
An L858R, liquid biopsy technology, applied in the biological field, can solve the problems of inability to obtain tumor tissue molecular detection, the sensitivity needs to be improved, and the tumor tissue is insufficient, so as to achieve the effects of cheap detection, fast detection, and simple operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1 Design of primers for detection of EGFR gene L858R mutation and its specificity and sensitivity verification.
[0035] 1. Query the target gene sequence: the identification number of the L858R mutant of EGFR in the NCBI SNP database is: rs121434568 (CATGTCAAGATCACAGATTTTGGGC[G / T]GGCCAAACTGCTGGGTGCGGAAGAG), where the wild type is T, the mutant is G, and the amino acid after mutation is L [Leu ] into R[Arg], forming a missense mutation.
[0036] 2. Design qPCR primers: reference figure 1 According to the qPCR design principle, oligo7 molecular software was used to design the upstream primer TGAAAACACCGCAGCATGTCA; the downstream L858R mutant enrichment amplification primer: GCACCCAGCAGTTTGGCTC; the downstream L858R wild type enrichment amplification primer: GCACCCAGCAGTTTGGCGA. Since the second base at the 3' end of the downstream primer is non-complementary to the template, only primers whose first base at the 3' end is complementary to the template can generat...
Embodiment 2
[0042] Example 2 is used for the detection of clinical samples by the EGFR / L858R mutation liquid biopsy kit.
[0043] 1. DNA extraction: Take 1 ml of whole blood, centrifuge at 2000 rpm for 10 min, transfer the supernatant to a new centrifuge tube; repeat the centrifugation, transfer the remaining supernatant to the centrifuge tube, and add 50 μl of mesoporous nano-magnetic beads; Regulate Na with NaCl + concentration to 0.4mol / L, vortex for 1 min; absorb at room temperature for 10 min; gently vortex the centrifuge tube for 5 sec, immediately place it on a magnetic adsorption rack, let it stand for 5 sec, and discard the liquid; wash with 300 μl ( 0.4 mol / L NaCl), repeat the above steps twice; open the lid and dry for 10 min, add 100 μl of deionized water, vortex and shake to mix, 65 ℃ water bath for 10 min; vortex the centrifuge tube for 10 sec, and immediately place it under magnetic force Put it on the adsorption rack, let it stand for 5 sec, absorb the liquid and store...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com