Supercharge Your Innovation With Domain-Expert AI Agents!

DNA fragment of bacillus subtilis with promoter function and application thereof

A Bacillus subtilis and promoter technology, applied in the field of DNA fragments, to achieve the effect of strong specific expression activity

Active Publication Date: 2017-07-14
SOUTH CHINA UNIV OF TECH
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the promoters successfully used in the expression system of Bacillus subtilis mainly include P43, PamyQ, Pspac, PxylA, etc. These promoters perform well in the enrichment medium of the laboratory, but they are rarely used in the industry of enzyme proteins scale up production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA fragment of bacillus subtilis with promoter function and application thereof
  • DNA fragment of bacillus subtilis with promoter function and application thereof
  • DNA fragment of bacillus subtilis with promoter function and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Culture of bacteria: Bacillus subtilis 168 was taken out from the -80°C glycerol tube and streaked on an LB solid plate at 37°C for 16-24h, and a single colony was picked and placed in 10mL of LB liquid with 1% final concentration of cornstarch culture medium, 37°C, 200rpm to OD 600 20-25 (spectrophotometer, Hitachi, Japan).

Embodiment 2

[0034] Extraction of bacterial total RNA, establishment of transcriptome library and RNA-Seq sequencing: collect 1 mL of the cell culture solution obtained in Example 1 and centrifuge rapidly at 8000g for 1 min to extract total bacterial RNA (see figure 1 ). For the specific extraction method, refer to the Bacterial Total RNA Extraction Kit from OmegaBio-tek Company. The samples used for RNA-Seq sequencing library preparation were qualified by the Agilent Technologies 2100 Bioanalyzer, and the mixed DNA molecules were treated with DNaseI (RNase Free), and Ribo-Zero (Gram-Positive Bacteria) kit (USA) was used to remove most of the total RNA. rRNA, purified mRNA. The mRNA was first broken into fragments of appropriate size, using the fragmented mRNA as a template, reverse transcriptase and random primers were added to synthesize double-stranded cDNA, and then the synthesized cDNA was purified with the kit QIAquick PCR Purification Kit (Qiagen). Fill in the cohesive ends of the...

Embodiment 3

[0036] Screening and cloning of promoter fragments: Analyze the transcript structure of Bacillus subtilis through RNA-Seq sequencing data and the genome-wide analysis of genes containing transcription start positions, and quantify by RPKM to screen a highly expressed gene and its nucleotide sequence As follows:

[0037]CGTTCTGTTACAGATGGAGGCGACAGCTTAATTTTTCTGCCTAATTCCCTCATCGACAAACGGCTGTCCTTCTTCAGCTCCTCAATGATATTCAGATCAATCTGGTCAAGTTTCATTTCAACATCCTTCTTTTTTGATTTTGTACACATTATCTCGGGTATTTTTGTAAATGACAAGTACAGTTCCCTAGAAAAGGCATGTAAAAATGAATGTTTTCCGAACATTTTTTGAAAGCTGTCATATGCCCCCCCGGATTGTTTATAGTATAAAATGAAAACGTGTCCACAAGGAGGGCGATTT。

[0038] Using the genomic DNA of the strain Bacillus subtilis (Bacillus subtilis 168) as a template, primers F-P ydzA (5'-CGGAATTCCGTTCTGTTACAGATGGAGG-3') and R-P ydzA (5'-GGACTAGTAAATCGCCCTCCTTGTGGAC-3') to amplify a 300bp DNA fragment, namely P ydzA Promoter fragment (see figure 2 ), consistent with the size of the target product. Introduced restriction site...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a DNA fragment of bacillus subtilis with a promoter function and application thereof. The DNA fragment is any one of a, the nucleotide sequence as shown in SEQ ID NO.1 or a complementary sequence thereof; b, a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides of the nucleotide sequence as shown in SEQ ID NO.1 and having the promoter function the same as that of the nucleotide sequence as shown in SEQ ID NO.1, or a complementary sequence thereof; and c, a sequence obtained by adding one or more ribosome bind sites to the nucleotide sequence as shown in SEQ ID NO.1. The DNA fragment has the promoter function, and also has high expression activity. High expression of exogenous genes can be achieved without adding an inductor. The DNA fragment can be applied to expression of thermostable beta-galactosidase and transglutaminase, and particularly, an effective element is provided for a bacillus subtilis expression-secretion system.

Description

technical field [0001] The invention relates to a DNA segment, in particular to a DNA segment with promoter function of Bacillus subtilis and its application. Background technique [0002] The production of valuable exogenous proteins by gene recombination technology is one of the hot spots in the research and development of biotechnology today. Bacteria have the characteristics of fast growth, easy culture, high expression and simple molecular manipulation, which makes them widely developed and applied to the expression of heterologous proteins. Among them, Bacillus subtilis has become an ideal host cell for industrial use due to its many advantages such as safety and non-toxicity, clear genetic background, and high secretion expression level. [0003] Various elements are required for expression of heterologous proteins in Bacillus subtilis, among which the promoter is crucial for the effect of expression level. There are usually two ways to genetically modify the promot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/75C12N1/21C12R1/125
CPCC12N15/113C12N15/75C12N2830/34
Inventor 潘力刘欣叶燕锐王斌
Owner SOUTH CHINA UNIV OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More