Anti-CTLA4-anti-PD-1 bifunctional antibody, pharmaceutical composition and use thereof

A PD-1, bispecific antibody technology, applied in the field of tumor therapy and molecular immunology

Active Publication Date: 2017-07-21
AKESO PHARMA INC
View PDF4 Cites 59 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0012] However, currently there are not even bifunctional antibodies on the market that target more than two targets on the same cell type, what is currently available in the world is antibodies against two different cell surface molecules

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-CTLA4-anti-PD-1 bifunctional antibody, pharmaceutical composition and use thereof
  • Anti-CTLA4-anti-PD-1 bifunctional antibody, pharmaceutical composition and use thereof
  • Anti-CTLA4-anti-PD-1 bifunctional antibody, pharmaceutical composition and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0310] Example 1: Preparation of Anti-CTLA4 Antibody 4G10

[0311] 1. Preparation of hybridoma cell line LT002

[0312] The antigen CTLA4-mFc used to prepare the anti-CTLA4 antibody is a fusion protein of human CTLA4 (GenbankID: NP_005205.2) extracellular region and mouse IgG1Fc. Splenocytes from immunized BALB / C mice (purchased from Guangdong Medical Experimental Animal Center) were fused with mouse myeloma cells to form hybridoma cells, referring to established methods (for example, Stewart, S.J., "Monoclonal Antibody Production", in Basic Methods in Antibody Production and Characterization, Eds. G.C. Howard and D.R. Bethell, Boca Raton: CRC Press, 2000).

[0313] The fusion protein CTLA4-mFc was digested with TEV protease, and the CTLA4 protein was obtained by column purification. Using CTLA4 protein as an antigen to coat the microtiter plate, performing indirect ELISA screening, and obtaining hybridoma cells secreting new antibodies specifically combined with CTLA4. T...

Embodiment 2

[0317] Example 2: Sequence Analysis of Anti-CTLA4 Antibody 4G10

[0318] Sequence Analysis of Antibody 4G10

[0319] The mRNA was extracted from the LT002 ​​cell line cultured in Example 1 according to the method of Cultured Cell Bacteria Total RNA Extraction Kit (Tiangen, Cat. No. DP430).

[0320] According to Invitrogen III First-Strand Synthesis System for RT-PCR Kit Instructions Synthesize cDNA and perform PCR amplification.

[0321] The PCR amplified product was directly cloned by TA, and the specific operation was carried out according to the instructions of the pEASY-T1 Cloning Kit (TransgenCT101) kit.

[0322] The products of TA clones were directly sequenced, and the sequencing results were as follows:

[0323] Nucleic acid sequence of heavy chain variable region: (372bp)

[0324] CAGGTCAAGCTGCAGGAGTCTGGACCTGAGCTGGTGAAGCCTGGAGCTTCAATGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGGCTACACCATGAACTGGGTGAAGCAGAGCCATGGAAAGAACCTTGAATGGATTGGACTTATTAATCCTTACAATAATATTACTAACTACAAC...

Embodiment 3

[0332] Example 3: Design and preparation of anti-CTLA4 humanized antibodies 4G10H1L1, 4G10H3L3 and 4G10H4L3

[0333] 1. Design of light chain and heavy chain sequences of anti-CTLA4 humanized antibodies 4G10H1L1, 4G10H3L3 and 4G10H4L3

[0334] According to the three-dimensional crystal structure of CTLA4 protein (Nat.Struct.Biol.(1997) 4p.527) and the sequence of antibody 4G10 obtained in Example 2, the antibody model was simulated by computer, and mutations were designed according to the model to obtain antibodies 44G10H1L1, 4G10H3L3 and 4G10H4L3 The variable region sequence (antibody constant region sequence, from NCBI database, the heavy chain constant region is Iggamma-1chain C region, ACCESSION: P01857, the light chain constant region is Ig kappa chain Cregion, ACCESSION: P01834).

[0335] The designed variable region sequence is as follows:

[0336] (1) Heavy chain and light chain sequences of humanized monoclonal antibody 4G10H1L1

[0337] Nucleic acid sequence of h...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Belonging to the field of tumor treatment and molecular immunology, the invention relates to an anti-CTLA4-anti-PD-1 bifunctional antibody, a pharmaceutical composition and use thereof. Specifically, the anti-CTLA4-anti-PD-1 bifunctional antibody comprises: a PD-1 (programmed death-1) targeted first protein functional region, and a CTLA4 (cytotoxic T lymphocyte sociated antigen 4) targeted second protein functional region. The bifunctional antibody provided by the invention can well bind to CTLA4 and PD-1 specifically, specifically remove the immunosuppression of CTLA4 and PD-1 on the body, and activate T lymphocytes, thus having good application prospect.

Description

technical field [0001] The invention belongs to the field of tumor treatment and molecular immunology, and relates to an anti-CTLA4-anti-PD-1 bifunctional antibody, its pharmaceutical composition and its application. Specifically, the present invention relates to an anti-CTLA4-anti-PD-1 monoclonal antibody. Background technique [0002] Cytotoxic T lymphocyte associated antigen-4 (CTLA4 for short) has a very similar relationship with CD28 molecule in gene structure, chromosomal location, sequence homology and gene expression, and both are costimulatory molecules The receptor of B7 is mainly expressed on the surface of activated T cells. The combination of CTLA4 and B7 can inhibit the activation of mouse and human T cells and play a negative regulatory role in T cell activation. [0003] CTLA4mAb or CTLA4 ligand can prevent CTLA4 from binding to its natural ligand, thereby blocking the negative regulatory signal transmission of T cells by CTLA4 and enhancing the reactivity ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K16/46C12N15/13C12N15/62G01N33/68G01N33/577A61K39/395A61P35/00A61P35/02A61P7/06
CPCC07K16/28C07K16/2818C07K16/468C07K2317/31G01N33/577A61P7/06A61P35/00A61P35/02C07K2317/24C07K2317/92C07K2317/70A61K2039/505G01N33/574G01N33/6854G01N2333/70521A61K39/395C07K16/46C12N15/62G01N33/68G01N33/6893G01N2800/7019C07K2317/622C07K2317/76
Inventor李百勇夏瑜王忠民张鹏
OwnerAKESO PHARMA INC